Información

Bowtie: ¿no puede leer el archivo fasta?

Bowtie: ¿no puede leer el archivo fasta?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estoy tratando de usarbowtie2analizar mis datos en formato FASTA, pero parece que esta versión no puede leer correctamente mis datos. Mi línea de comando es la siguiente:

bowtie2 -x $ REFERENCIA -f $ OBJETIVOS -S $ OBJETIVO.sam

La versión 2 de bowtie se queja de lo siguiente:

Advertencia: omitiendo la lectura 'ORIGINAL: GACACTGTTCATGCTGGTGTCGCTGTCGGGCATTAT' porque la longitud (0) <= # no coincide con la semilla (0) Advertencia: omitiendo la lectura 'ORIGINAL: GACACTGTTCATGCTGGTGTCGCTGTCGGGCATTAT' porque tenía <2 caracteres de longitud de lectura de ORIGINAL GAGTGCT: 0) <= # desajustes de semillas (0)

Tenga en cuenta quecorbata de moño(versión 1) está satisfecho con mi FASTA! Aquí hay un fragmento y quécorbata de moñodice:

> ORIGINAL: GCTACGGAATAAAACCAGGAACAACAGACCCAGCAC GCTACGGAATAAAACCAGGAACAACAGACCCAGCAC> ORIGINAL: ATTAACAACAAAGGGTAAAAGGCATCATGGCTTCAG ATTAACAACAAAGGGTAAAAGGCATCATGGCTTCAG> ORIGINAL: GCAGAAAATGGGAGTGAAAATCTCCGATGAGCAGCT AATGGGAGTGAAAATCTCCGATGAGCAGC # lee procesada: 471409 # lee con al menos un informó alineación: 464 583 (98.55%) # lee que no consiguieron align: 6826 (1,45%)

Ahora estoy perdido. ¿Alguien puede ver lo que estoy haciendo mal aquí? ¿Puedo confiar de todos modos?bowtie2cuando termina y da salida, ¿cuántas secuencias están alineadas?

¡Gracias!


Como aparentemente no tengo suficiente reputación para comentar, publicaré esto como respuesta y dejaré que alguien lo mueva.

En primer lugar, intente asegurarse de que el orden de los argumentos sea correcto. Deberías estar escribiendobowtie2 -f -x $ OBJETIVO -U $ OBJETIVOS -S $ OBJETIVO.sam, ya que bowtie2 (como con muchos otros programas) puede ser un poco exigente con el orden de los argumentos.

En segundo lugar, generalmente es aconsejable que la entrada de ejemplo incluya líneas que están causando el problema (dado que aparentemente no se queja de las líneas que publicó, solo podemos asumir que las está alineando).

En tercer lugar, normalmente solo recibirá esas advertencias si son ciertas. Por ejemplo, si tuvieras quegrep -A 1 -w GACACTGTTCATGCTGGTGTCGCTGTCGGGCATTAT $ objetivoentonces mi conjetura es que encontraría que no tiene ninguna secuencia restante. Presumiblemente, estos son el resultado de recortar adaptadores o algo así, así que haga que su recortadora descarte los resultados realmente cortos (de todos modos no se alinearán de manera significativa).


Alineando las lecturas con el transcriptoma

Armado con el archivo fasta agrupado y las lecturas sin procesar recortadas, ahora puede determinar los aciertos de lectura por transcripción.

Las funciones de alineación son compatibles con la plataforma Trinity, incorporando así el uso de estas herramientas de terceros, siempre que estén instaladas. El software instalado requerido incluye Bowtie (usé v1.1.2) y SAMtools (v1.2) para dar salidas de archivos bam. También se requiere Perl y, por supuesto, Trinity & # 8211 si se ejecuta dentro de las utilidades optimizadas.

#PBS -P nombre del proyecto
#PBS -N AP0_alignment
#PBS -l nodos = 1: ppn = 20
#PBS -l walltime = 20:00:00
#PBS -l pmem = 24 GB
#PBS -e ./AP0_alignment.txt
#PBS -M [email protected]
#PBS -m abe

# Módulos de carga
módulo de carga perl
pajarita de carga del módulo
módulo de carga java
módulo de carga samtools / 1.2
módulo de carga trinity / 2.1.1

# Directorio de trabajo
cd / ruta al directorio de trabajo

# Ejecutar script de pajarita
/usr/local/trinity/2.1.1/util/bowtie_PE_separate_then_join.pl & # 8211seqType fq
& # 8211left AP0_R1_pairedwithunpaired.trim.fq & # 8211right AP0_R2_pairedwithunpaired.trim.fq
& # 8211target Syzygium.fasta & # 8211aligner bowtie
& # 8212 -p 4 & # 8211todos & # 8211best & # 8211strata -m 300

A partir de esto, se generará una carpeta llamada bowtie que contiene archivos bam y bams indexados. Para el siguiente paso, utilizará los archivos bam de todas las muestras y todos los tiempos para determinar los recuentos por transcripción. Cambie el nombre de los archivos bam de acuerdo con la planta / tiempo, por ejemplo. AP0_coordSorted.bam y AP0_coordSorted.bam.bai


Versión 2.4.2 - 5 de octubre de 2020

  • Se solucionó un problema que causaba que el script de envoltura bowtie2 arrojara un error al usar argumentos específicos de envoltura.
  • Se agregó un nuevo indicador --sam-append-comment que agrega el comentario de FASTA / Q leído al registro SAM correspondiente.
  • Se solucionó un problema que causaba que qupto, -u, se desbordara cuando hay & gt = 2 32 secuencias de consulta (PR # 312).
  • Se solucionó un problema que causaba que el script bowtie2-build procesara incorrectamente los archivos de referencia.

Trinity: Error no puede encontrar el camino a bowtie2 # 452

El texto se actualizó correctamente, pero se encontraron estos errores:

Kubu4 comentado Oct 24, 2018

No estoy seguro de lo que pegaste aquí.

No deberías tener todos estos:

Kubu4 comentado Oct 24, 2018

¿Dónde está ubicado tu guión? No lo encuentro.

Además, necesitaba esta línea la última vez que ejecuté Trinity (no resuelve el error de pajarita, pero evitará un problema con Trinity más adelante)

Kubu4 comentado Oct 24, 2018

El error bowtie2 se debe a que bowtie2 no está actualmente en su $ PATH. Eso significa que probablemente también tendrá que agregar medusas y salmón a su $ PATH.

Para hacerlo, agregue el siguiente texto a su

Gracia-ac comentado Oct 24, 2018

¡Sí, no estoy del todo seguro de lo que estoy haciendo!

Literalmente, simplemente copié y pegué el script de TextWrangler en mi terminal mientras estaba conectado a Mox.

. Lo que ahora entiendo no es el camino a seguir. Ahora estoy pensando en enviar el trabajo a través del archivo de secuencia de comandos en lugar de copiarlo y pegarlo.

Kubu4 comentado Oct 24, 2018

Correcto, no puede copiar y pegar el script para ejecutarlo. El script tiene que estar en Mox y luego necesita un comando especial para ejecutarlo, vea la wiki de Mox.

Kubu4 comentado Oct 24, 2018

Miré el guión. Necesita poner el material PATH personalizado en su

Kubu4 comentado Oct 24, 2018

Además, después de agregar eso a su

./bashrc, deberá obtener el archivo para que la computadora encuentre la nueva información:

Archivo /.bashrc. - Estás recibiendo esto porque estás suscrito a este hilo. Responda a este correo electrónico directamente, véalo en GitHub o silencia el hilo.

Gracia-ac comentado Oct 24, 2018

/.bashrc es lo mismo que el archivo de script?

/.bashrc es lo mismo que el archivo de script? - Estás recibiendo esto porque comentaste. Responda a este correo electrónico directamente, véalo en GitHub o silencie el hilo.

/.bashrc es lo mismo que el archivo de script? - Estás recibiendo esto porque comentaste. Responda a este correo electrónico directamente, véalo en GitHub o silencie el hilo.

Kubu4 comentado Oct 25, 2018

Esos programas deben estar disponibles en el sistema $ PATH para que Trinity se ejecute. Las rutas absolutas o relativas no tienen relación, siempre que los programas estén disponibles en el sistema $ PATH.

Kubu4 comentado Oct 25, 2018

O tal vez ese comando export PATH voluntad trabaje en su script SBATCH de la forma en que ya lo tiene. Mmm.

Gracia-ac comentado Oct 25, 2018

bueno, supongo que lo averiguaremos! acaba de comenzar a ejecutar trabajo en Mox

Kubu4 comentado Oct 25, 2018

Sin embargo, noté que usará esta versión de Trinity:

Esa es una versión bastante antigua (2.40) y tiene casi dos años en este momento. Recomiendo usar la versión más nueva:

Sin embargo, dado que usará la versión anterior, no creo que realmente necesite esos programas en su PATH, creo que venían incluidos con Trinity en ese entonces.

Gracia-ac comentado Oct 28, 2018

Arreglará la versión de Trinity en el script y volverá a hacerlo.

¿Alguna otra cosa que deba solucionar antes de volver a enviar el trabajo?

Gracia-ac comentado Oct 28, 2018

Oh, no leí completamente el error correctamente. Pensé que decía que no podía ejecutar trinity porque no era la versión actualizada.

¡Verificaré los archivos fq y los compararé con la fuente!

Gracia-ac comentado Oct 30, 2018

Estos son los archivos que tenía en el script:

Estos son los archivos que están en trinity_out_dir:

Los números son correctos en los nombres de archivo .fastq, pero no estoy seguro si las extensiones agregadas de ".PwU.qtrim.fq" significan que hubo un problema.

Kubu4 comentado Oct 30, 2018

pero es probable que haya un problema con sus archivos fq

¿Porque piensas esto? No te estoy siguiendo.

Gracia-ac comentado Oct 30, 2018

los archivos son de / nightingales / C_bairdi /. Los descargué y luego los cargué en mi directorio de datos en mox.

Kubu4 comentado Oct 30, 2018

MD5 es un programa que genera un código único (suma de comprobación) para un archivo. La transferencia de datos de un lugar a otro puede dañar un archivo (los archivos más grandes son más propensos a la corrupción durante la transferencia). Puede utilizar la suma de comprobación MD5 generada originalmente para el archivo para comparar la suma de comprobación MD5 generada después de que se transfiera un archivo. Si las sumas de comprobación coinciden, significa que el archivo transferido es exactamente el mismo que el original. Si las sumas de comprobación no coinciden, algo se corrompió durante la transferencia.

Por lo tanto, cada vez que copie / mueva cualquier archivo FastQ, debe comparar las sumas de comprobación.

Consejo profesional: el uso de rsync para copiar archivos tiene esta funcionalidad incorporada y lo hará automáticamente.


Pajarita 2 es una herramienta ultrarrápida y de memoria eficiente para alinear las lecturas de secuenciación con secuencias de referencia largas. Es particularmente bueno para alinear lecturas de aproximadamente 50 hasta 100 o miles de caracteres, y particularmente bueno para alinear con genomas relativamente largos (por ejemplo, de mamíferos). Bowtie 2 indexa el genoma con un índice FM para mantener pequeña su huella de memoria: para el genoma humano, su huella de memoria suele ser de alrededor de 3,2 GB. Bowtie 2 admite modos de alineación con espacios, local y emparejado.

Pajarita 2 está disponible en varios administradores de paquetes, en particular Bioconda. Con Bioconda instalado, debería poder instalar Bowtie 2 con conda install bowtie2.

Las versiones en contenedores de Bowtie 2 también están disponibles a través del proyecto Biocontainers (por ejemplo, a través de Docker Hub).

También puede descargar fuentes y binarios de Bowtie 2 desde la pestaña "lanzamientos" en esta página. Los binarios están disponibles para Linux, Mac OS X y Windows. Al utilizar el proyecto SIMDE, Bowtie 2 ahora admite las siguientes arquitecturas: ARM64, PPC64 y s390x. Si planea compilar Bowtie 2 usted mismo, asegúrese de tener al menos la biblioteca zlib y los archivos de encabezado instalados. Consulte la sección Construir a partir de la fuente del manual para obtener más detalles.

¿Quieres probar Bowtie 2? Echa un vistazo a la interfaz de usuario de Bowtie 2 (actualmente en versión beta).

bowtie2 toma un índice Bowtie 2 y un conjunto de archivos de lectura en secuencia y genera un conjunto de alineaciones en formato SAM.

La "alineación" es el proceso mediante el cual descubrimos cómo y dónde las secuencias leídas son similares a la secuencia de referencia. Una "alineación" es el resultado de este proceso, específicamente: una alineación es una forma de "alinear" algunos o todos los caracteres en la lectura con algunos caracteres de la referencia de una manera que revela en qué se parecen. Por ejemplo:

Donde los símbolos de guión representan espacios y las barras verticales muestran dónde coinciden los caracteres alineados.

Usamos la alineación para hacer una suposición fundamentada sobre dónde se originó una lectura con respecto al genoma de referencia. No siempre es posible determinar esto con certeza. Por ejemplo, si el genoma de referencia contiene varios tramos largos de As (AAAAAAAAA, etc.) y la secuencia de lectura es un tramo corto de As (AAAAAAA), no podemos saber con certeza exactamente en qué lugar del mar de As se originó la lectura.

bowtie2-build construye un índice Bowtie a partir de un conjunto de secuencias de ADN. bowtie2-build genera un conjunto de 6 archivos con los sufijos .1.bt2, .2.bt2, .3.bt2, .4.bt2, .rev.1.bt2 y .rev.2.bt2. En el caso de un índice grande, estos sufijos tendrán una terminación bt2l. Estos archivos juntos constituyen el índice: son todo lo que se necesita para alinear las lecturas con esa referencia. Bowtie 2 ya no utiliza los archivos de secuencia original FASTA una vez que se crea el índice.

El formato de índice .bt2 de Bowtie 2 es diferente del formato .ebwt de Bowtie 1 y no son compatibles entre sí.

bowtie2-inspect extrae información de un índice Bowtie 2 sobre qué tipo de índice es y qué secuencias de referencia se utilizaron para construirlo. Cuando se ejecuta sin ninguna opción, la herramienta generará un archivo FASTA que contiene las secuencias de las referencias originales (con todos los caracteres que no son A / C / G / T convertidos a Ns). También se puede usar para extraer solo los nombres de secuencia de referencia usando la opción -n / - names o un resumen más detallado usando la opción -s / - summary.


Ahora alineemos nuestras lecturas usando pajarita

(Nota: para simplificar, colocaremos todos los archivos relacionados con bowtie en el mismo directorio. Para su propio trabajo, es posible que desee organizar su estructura de archivos mejor que nosotros).

Consigamos pajarita de Sourceforge:

descomprima el archivo y cree un directorio para bowtie. En este caso, el programa está precompilado, por lo que viene como un ejecutable binario:

Copie los archivos bowtie en un directorio en su ruta de búsqueda de shell y luego vuelva al directorio principal (/ data / drosophila):

Creemos un nuevo directorio, "drosophila_bowtie", donde vamos a colocar todos los resultados de la pajarita:

Ahora vamos a construir un índice del genoma de Drosophila usando pajarita como hicimos con bwa. El genoma de referencia original de Drosophila está en la misma ubicación que usamos antes. Una vez más, ya hemos realizado el paso de indexación (tarda unos 7 minutos), por lo que si desea probarlo usted mismo, indexe una copia para no sobrescribir la que hemos ejecutado previamente para usted:

¡Ahora llegamos al mapa! Vamos a utilizar las opciones predeterminadas para pajarita por el momento. Repasemos esto. Hay un par de indicadores que hemos establecido, ya que hemos emparejado lecturas finales para estas muestras y varios procesadores. El formato general de pajarita es (no ejecute esto):

Sin embargo, tenemos algunos detalles más que queremos incluir, por lo que hay un par de banderas que tenemos que configurar. -S significa que queremos la salida en formato SAM. -p 2 es para subprocesos múltiples (usando más de un procesador). En este caso tenemos dos para usar. -1 -2 le dice a Bowtie que estos son pares de lecturas finales (el .fastq), y especifica cuál es cuál.

Esto debería tardar entre 35 y 40 minutos en ejecutarse en el conjunto de datos completo, por lo que lo ejecutaremos en una versión recortada (debería tardar unos 3 minutos más tarde, le daremos resultados precalculados para el conjunto completo):

Es posible que vea mensajes de advertencia como:

Hablaremos sobre algunas opciones que puede configurar para lidiar con esto.

Algunos argumentos / opciones útiles adicionales (al menos para mí) -m # Suprime todas las alineaciones para una lectura en particular si existen más de m alineaciones notificables. -v # no más de v desajustes en toda la longitud de la lectura -n -l # número máximo de desajustes en la "semilla" de alta calidad, que son los primeros l pares de bases de una lectura. -chunkmbs # número de mb de memoria que se le da a un hilo para almacenar la ruta. Útil cuando recibe advertencias como las anteriores - lo mejor # hace que Bowtie “garantice” que las alineaciones de singleton informadas son las “mejores” dadas las opciones –tráyase # esforzarse por encontrar alineaciones válidas, cuando salgan. MUY LENTO.


Razón fundamental

Las mejoras en la eficiencia de la secuenciación de ADN han ampliado las aplicaciones para la secuenciación y han aumentado drásticamente el tamaño de los conjuntos de datos de secuenciación. Se han utilizado tecnologías de Illumina (San Diego, CA, EE. UU.) Y Applied Biosystems (Foster City, CA, EE. UU.) Para perfilar patrones de metilación (MeDIP-Seq) [1], para mapear interacciones ADN-proteína (ChIP-Seq) [ 2], e identificar genes expresados ​​diferencialmente (RNA-Seq) [3] en el genoma humano y otras especies. El instrumento Illumina se utilizó recientemente para volver a secuenciar tres genomas humanos, uno de un paciente con cáncer y dos de grupos étnicos no secuenciados previamente [4-6]. Cada uno de estos estudios requirió la alineación de un gran número de secuencias cortas de ADN ('lecturas cortas') en el genoma humano. Por ejemplo, dos de los estudios [4, 5] utilizaron la herramienta de alineación de lectura corta Maq [7] para alinear más de 130 mil millones de bases (aproximadamente 45 × cobertura) de lecturas cortas de Illumina con un genoma de referencia humano para detectar variaciones genéticas. . El tercer estudio de re-secuenciación en humanos [6] utilizó el programa SOAP [8] para alinear más de 100 mil millones de bases con el genoma de referencia. Además de estos proyectos, el proyecto 1,000 Genomes está en proceso de utilizar instrumentos de secuenciación de alto rendimiento para secuenciar un total de aproximadamente seis billones de pares de bases de ADN humano [9].

Con los métodos existentes, el costo computacional de alinear muchas lecturas cortas con el genoma de un mamífero es muy grande. Por ejemplo, extrapolando los resultados presentados aquí en las Tablas 1 y 2, se puede ver que Maq requeriría más de 5 meses de unidad de procesamiento central (CPU) y SOAP más de 3 años de CPU para alinear los 140 mil millones de bases del estudio. por Ley y colaboradores [5]. Aunque se ha demostrado que el uso de Maq o SOAP para este propósito es factible mediante el uso de múltiples CPU, existe una clara necesidad de nuevas herramientas que consuman menos tiempo y recursos computacionales.

Maq y SOAP adoptan el mismo enfoque algorítmico básico que otras herramientas de mapeo de lectura recientes como RMAP [10], ZOOM [11] y SHRiMP [12]. Cada herramienta crea una tabla hash de oligómeros cortos presentes en las lecturas (SHRiMP, Maq, RMAP y ZOOM) o en la referencia (SOAP). Algunos emplean avances teóricos recientes para alinear las lecturas rápidamente sin sacrificar la sensibilidad. Por ejemplo, ZOOM usa 'semillas espaciadas' para superar significativamente a RMAP, que se basa en un algoritmo más simple desarrollado por Baeza-Yaetes y Perleberg [13]. Se ha demostrado que las semillas espaciadas producen una mayor sensibilidad que las semillas contiguas de la misma longitud [14, 15]. SHRiMP emplea una combinación de semillas espaciadas y el algoritmo de Smith-Waterman [16] para alinear las lecturas con alta sensibilidad a expensas de la velocidad. Eland es un programa de alineación comercial disponible en Illumina que utiliza un algoritmo basado en hash para alinear las lecturas.

Bowtie utiliza una estrategia de indexación diferente y novedosa para crear un alineador de lectura corta ultrarrápido y eficiente en la memoria orientado a la re-secuenciación de mamíferos. En nuestros experimentos con lecturas del proyecto 1,000 Genomes, Bowtie alinea lecturas de 35 pares de bases (pb) a una velocidad de más de 25 millones de lecturas por hora de CPU, que es más de 35 veces más rápido que Maq y 300 veces más rápido que SOAP en las mismas condiciones (ver Tablas 1 y 2). Bowtie emplea un índice de Burrows-Wheeler basado en el índice de espacio de minutos (FM) de texto completo, que tiene una huella de memoria de solo 1,3 gigabytes (GB) para el genoma humano. El tamaño reducido permite que Bowtie se ejecute en una computadora de escritorio típica con 2 GB de RAM. El índice es lo suficientemente pequeño como para distribuirse a través de Internet y almacenarse en el disco y reutilizarse. Se pueden usar varios núcleos de procesador simultáneamente para lograr una velocidad de alineación aún mayor. Hemos utilizado Bowtie para alinear el valor de cobertura de 14.3 veces de las lecturas humanas de Illumina del proyecto 1,000 Genomes en aproximadamente 14 horas en una sola computadora de escritorio con cuatro núcleos de procesador.

Bowtie hace una serie de compromisos para lograr esta velocidad, pero estas compensaciones son razonables dentro del contexto de los proyectos de re-secuenciación de mamíferos. Si existen una o más coincidencias exactas para una lectura, entonces se garantiza que Bowtie informará una, pero si la mejor coincidencia es una inexacta, no se garantiza que Bowtie en todos los casos encuentre la alineación de la más alta calidad. Con su configuración de rendimiento más alta, Bowtie puede fallar al alinear una pequeña cantidad de lecturas con alineaciones válidas, si esas lecturas tienen múltiples desajustes. Si se desean garantías más sólidas, Bowtie admite opciones que aumentan la precisión a costa de cierto rendimiento. Por ejemplo, la opción '--mejor' garantizará que todas las alineaciones informadas sean las mejores en términos de minimizar los desajustes en la parte inicial de la lectura, aunque esta opción incurre en un costo computacional adicional.

Con sus opciones predeterminadas, la sensibilidad de Bowtie medida en términos de lecturas alineadas es igual a la de SOAP y algo menor que la de Maq. Las opciones de la línea de comandos permiten al usuario aumentar la sensibilidad a costa de un mayor tiempo de ejecución, y permitir que Bowtie informe múltiples accesos para una lectura. Bowtie puede alinear lecturas tan cortas como cuatro bases y hasta 1.024 bases. La entrada a una sola ejecución de Bowtie puede comprender una mezcla de lecturas con diferentes longitudes.


El programa FASTP original fue diseñado para la búsqueda de similitudes de secuencias de proteínas. Debido a la información genética en expansión exponencial y la velocidad y memoria limitadas de las computadoras en la década de 1980, se introdujeron métodos heurísticos alineando una secuencia de consulta con bases de datos completas. FASTA, publicado en 1987, agregó la capacidad de realizar búsquedas de ADN: ADN, proteínas traducidas: búsquedas de ADN, y también proporcionó un programa de mezcla más sofisticado para evaluar la significación estadística. [2] Hay varios programas en este paquete que permiten la alineación de secuencias de proteínas y secuencias de ADN. Hoy en día, el mayor rendimiento de la computadora permite realizar búsquedas para la detección de alineación local en una base de datos utilizando el algoritmo de Smith-Waterman.

FASTA se pronuncia "fast A" y significa "FAST-All", porque funciona con cualquier alfabeto, una extensión de las herramientas de alineación "FAST-P" (proteína) y "FAST-N" (nucleótidos) originales.

El paquete FASTA actual contiene programas para proteína: proteína, ADN: ADN, proteína: ADN traducido (con cambios de marco) y búsquedas de péptidos ordenadas o desordenadas. Las versiones recientes del paquete FASTA incluyen algoritmos de búsqueda traducidos especiales que manejan correctamente los errores de cambio de marco (que las búsquedas traducidas de seis marcos no manejan muy bien) al comparar datos de secuencias de nucleótidos con proteínas.

Además de los métodos de búsqueda heurística rápida, el paquete FASTA proporciona SSEARCH, una implementación del algoritmo óptimo de Smith-Waterman.

Un enfoque principal del paquete es el cálculo de estadísticas de similitud precisas, de modo que los biólogos puedan juzgar si es probable que una alineación haya ocurrido por casualidad, o si se puede usar para inferir homología. El paquete FASTA está disponible en la Universidad de Virginia [3] y el Instituto Europeo de Bioinformática. [4]

El formato de archivo FASTA utilizado como entrada para este software ahora se utiliza en gran medida por otras herramientas de búsqueda de bases de datos de secuencias (como BLAST) y programas de alineación de secuencias (Clustal, T-Coffee, etc.).

FASTA toma una determinada secuencia de nucleótidos o aminoácidos y busca en una base de datos de secuencias correspondiente utilizando la alineación de secuencias locales para encontrar coincidencias de secuencias de bases de datos similares.

El programa FASTA sigue un método en gran parte heurístico que contribuye a la alta velocidad de su ejecución. Inicialmente, observa el patrón de aciertos de palabras, coincidencias palabra a palabra de una longitud determinada y marca las coincidencias potenciales antes de realizar una búsqueda optimizada que requiere más tiempo utilizando un algoritmo del tipo Smith-Waterman.

El tamaño tomado para una palabra, dado por el parámetro kmer, controla la sensibilidad y velocidad del programa. Al aumentar el valor de k-mer, se reduce el número de coincidencias de fondo que se encuentran. A partir de la palabra aciertos que se devuelven, el programa busca segmentos que contengan un grupo de aciertos cercanos. Luego investiga estos segmentos para una posible coincidencia.

Existen algunas diferencias entre fastn y fastp relacionadas con el tipo de secuencias utilizadas, pero ambos utilizan cuatro pasos y calculan tres puntuaciones para describir y formatear los resultados de similitud de secuencia. Estos son:

  • Identifique las regiones de mayor densidad en cada comparación de secuencias. Tomando un k-mer para igualar 1 o 2.
  • Vuelva a escanear las regiones tomadas utilizando las matrices de puntuación. recortar los extremos de la región para incluir solo aquellos que contribuyan al puntaje más alto.
  • En una alineación, si se encuentran varias regiones iniciales con puntuaciones superiores a un valor CUTOFF, compruebe si las regiones iniciales recortadas se pueden unir para formar una alineación aproximada con espacios. Calcule una puntuación de similitud que sea la suma de las regiones unidas penalizando por cada hueco 20 puntos. Esta puntuación de similitud inicial (initn) se utiliza para clasificar las secuencias de la biblioteca. Se informa la puntuación de la mejor región inicial individual encontrada en el paso 2 (init1).
  • Utilice un algoritmo de Smith-Waterman con bandas para calcular una puntuación óptima para la alineación.

FASTA no puede eliminar regiones de baja complejidad antes de alinear las secuencias como es posible con BLAST. Esto podría ser problemático cuando la secuencia de consulta contiene tales regiones, p. Ej. mini o microsatélites que repiten la misma secuencia corta con frecuencia, esto aumenta la puntuación de secuencias no familiares en la base de datos que solo coinciden en estas repeticiones, que ocurren con bastante frecuencia. Por lo tanto, el programa PRSS se agrega al paquete de distribución de FASTA. PRSS baraja las secuencias coincidentes en la base de datos, ya sea en el nivel de una letra o baraja segmentos cortos cuya longitud puede determinar el usuario. Las secuencias mezcladas ahora están alineadas nuevamente y si la puntuación sigue siendo más alta de lo esperado, esto se debe a que las regiones de baja complejidad se mezclan y siguen mapeando a la consulta. Por la cantidad de puntuación, las secuencias barajadas todavía alcanzan PRSS ahora puede predecir la importancia de la puntuación de las secuencias originales. Cuanto mayor sea la puntuación de las secuencias mezcladas, menos significativas serán las coincidencias encontradas entre la base de datos original y la secuencia de consulta. [5]

Los programas FASTA encuentran regiones de similitud local o global entre secuencias de proteínas o ADN, ya sea buscando en bases de datos de proteínas o ADN, o identificando duplicaciones locales dentro de una secuencia. Otros programas proporcionan información sobre la importancia estadística de una alineación. Al igual que BLAST, FASTA se puede utilizar para inferir relaciones funcionales y evolutivas entre secuencias, así como para ayudar a identificar miembros de familias de genes.


Bowtie: ¿no puede leer el archivo fasta? - biología

Los pasos analíticos están preestablecidos y dados por los administradores de la tubería. Envíe un correo electrónico a [email protected] si tiene alguna pregunta.

1. Mapeo del genoma de referencia

1-1. Pasos analíticos de las respectivas herramientas analíticas

(1) Maq
Maq realiza un análisis por cada 200 millones de lecturas, por lo que dividimos un archivo de consulta en varios archivos.

En el caso de análisis de un solo extremo:

Lecturas divididas 200M con ventana de vista detallada.
leer: RUN Accession_0000
RUN Accession_0001


Pasos
Herramienta
Explicación
maq fasta2bfa in.ref.fasta out.ref.bfa Maq Prepárese para hacer la 'alineación'.
Convierta el formato de archivo de la referencia FASTA a bfa.
maq fastq2bfq (fasta2bfa) in.read1.fastq (.fasta) out.read1.bfq (.bfa) Maq Prepárese para hacer la 'alineación'.
Convierta el formato de archivo de las lecturas FASTA a bfq.
maq map [opción] out_0.map in.ref.bfa in.read1.bfq (.bfa) Maq Alinee las lecturas con las secuencias de referencia.
maq mapmerge out_all.map out_0.map out_1.map .... Maq Marque el resultado para dividir y alinear el archivo de consulta.
maq mapview out_all.map mapview.txt Maq Convierta el formato de archivo del binario resultante en texto.
El resultado de la alineación se incluyó en 'mapview.txt'.
maq mapcheck in.ref.bfa out_all.map & gt mapcheck.txt Maq Compruebe las cualidades de las lecturas.
El resultado se incluyó en 'mapcheck.txt'.
maq indelsoa in.ref.bfa out_all.map & gt out.indel.soa Maq Detección de indeles y puntos de rotura.
El resultado se incluyó en el archivo 'out.indel.soa'.
maq ensamblar [opción] out.cns in.ref.bfa out_all.map Maq Generación de las secuencias consenso de los alineamientos.
El resultado se incluyó en el archivo 'out.cns'.
maq cns2snp out.cns & gt out.snp Maq Detección de SNP.
El resultado se incluyó en el archivo 'out.snp'.
maq.pl SNPfilter [opción] out.snp & gt out.filter.snp Maq Filtro SNP.
maq2sam out_all.map & gt out.sam SAMtools
Convierta el formato de la alineación Maq a SAM.
El resultado con formato SAM en SAM se incluyó en 'out.sam'.

En el caso del análisis Paired-end:

Dividir 200 millones de lecturas cada una, las que procesadas aparecieron en la 'Vista detallada' de la tubería, como a continuación.

read1: EJECUTAR Accession_1_0000
EJECUTAR Accession_1_0001

read2: EJECUTAR Accession_2_0000
EJECUTAR Accession_2_0001

ej.) leer1: DRR000001_1_0000
read2: DRR000001_2_0000


Ver el vídeo: Copiar secuencia en NCBI formato FASTA (Noviembre 2022).