Información

Métodos para variar el tamaño del inserto en clones de E. coli

Métodos para variar el tamaño del inserto en clones de E. coli


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estoy escribiendo la propuesta de mi tesis de maestría y necesito mejorar el comportamiento de solución de algunos dominios de proteínas truncados que previamente han mostrado poca solubilidad cuando se expresan en E. coli.

Para evitar esta agregación no deseada, un experimento que realizaré será alterar los límites del dominio. Crearé construcciones de genes donde cada clon tendrá un dominio A de cierta longitud y borde de dominio (ver más abajo).

Mi pregunta: ¿Es la clonación de Gateway mejor que los métodos de restricción / ligasa para esto? Si utilizo métodos de restricción / ligasa para construir vectores de transformación, entonces mi elección de límites de dominio estará determinada por los sitios de restricción. Sin embargo, con un sistema como la clonación de Gateway, puedo definir límites de límites para la resolución de pb simplemente diseñando un cebador apropiado.

¿Es correcto mi razonamiento aquí? Necesito justificar mis elecciones de diseño experimental a los investigadores, así que quiero asegurarme de que soy eficiente y lógico.


Si. En principio, tendrá una capacidad mucho mayor para personalizar los límites de cada dominio de proteína con un enfoque basado en el cebador y la PCR. No es obvio para mí que se requiera el sistema de clonación de puerta de enlace, o que sea necesariamente la mejor opción para este enfoque, pero es probable que sea subjetivo.

¿Conoce o conoce los esfuerzos del SGC (Consorcio de Genómica Estructural)? Tengo entendido (ahora algo desactualizado) que iban a diseñar / usar una forma semiautomática de implementar la estrategia que usted analiza (recorte de dominio) para que pudieran utilizar un enfoque de alto rendimiento para definir las condiciones de cristalización para sus objetivos. ¿Quizás podría adaptar su (s) método (s) a su proteína de interés?


Construcción de bibliotecas de ADN genómico de inserto pequeño altamente enriquecidas para secuencias repetidas de microsatélites

Describimos un método eficaz para la construcción de bibliotecas genómicas de inserto pequeño enriquecidas para repeticiones de secuencias simples y altamente polimórficas. Con este enfoque, se producen bibliotecas en las que el 40-50% de los miembros contienen repeticiones de (CA) n, lo que representa un enriquecimiento de aproximadamente 50 veces con respecto a las bibliotecas convencionales de ADN genómico de inserto pequeño. Brevemente, se construyó una biblioteca genómica con un tamaño de inserto promedio de menos de 500 pares de bases en un vector fagémido. La amplificación de esta biblioteca en una cepa holandesa de Escherichia coli permitió la recuperación de la biblioteca como ADN monocatenario circular cerrado con uracilo frecuentemente incorporado en lugar de timina. Este ADN se utilizó como molde para la síntesis de ADN de segunda hebra, cebado con oligonucleótidos (CA) n o (TG) n, a temperaturas elevadas mediante una ADN polimerasa termoestable. La transformación de esta mezcla en cepas de E. coli de tipo salvaje dio como resultado la recuperación de productos con cebador extendido como consecuencia de la fuerte selección genética contra moléculas de ADN monocatenarias que contienen uracilo. De esta manera, se recuperó una biblioteca altamente enriquecida para los clones que contienen microsatélites diana. Este enfoque es ampliamente aplicable y puede usarse para generar bibliotecas seleccionadas por marcadores que lleven cualquier repetición de secuencia simple de ADNc, genomas completos, cromosomas únicos o regiones cromosómicas de interés más restringidas.


Fondo

Las construcciones diseñadas son la base de muchas técnicas experimentales en genética y genómica. Por ejemplo, la perturbación dirigida de la función génica mediante la interferencia de ARN o CRISPR / Cas9 permite la agrupación de pantallas genéticas de todo el genoma que se pueden leer a través de la secuenciación de próxima generación (NGS) del ARN en horquilla pequeña (shRNA) [1, 2]. o construcciones de ARN guía sintético (ARNsg) [3, 4, 5, 6], o etiquetas de secuencia / códigos de barras asociados [7]. Los elementos transponibles también se usan comúnmente para mutar o manipular loci genéticos, y de manera similar permiten pantallas de mutagénesis de saturación a escala del genoma en las que se mide la unión transposón-genoma usando NGS [8]. Los enfoques de rastreo de linaje [9, 10] y conectómica [11, 12] también se basan en la cuantificación de etiquetas moleculares basada en NGS. En todos estos enfoques, la amplificación por reacción en cadena de la polimerasa (PCR) se utiliza para enriquecer las etiquetas de secuencia y para agregar adaptadores y otras funcionalidades (por ejemplo, códigos de barras específicos de la muestra) necesarios para la secuenciación. Sin embargo, la PCR introduce sesgos en estas mediciones. Las etiquetas de secuencia compuestas por shRNA, sgRNA, uniones transposón-genoma o códigos de barras sintéticos pueden diferir en la secuencia primaria y las propiedades biofísicas, que, junto con otras variables como la concentración de la plantilla y las condiciones de la PCR, pueden influir en la eficiencia de la amplificación de formas impredecibles [13, 14,15]. La adición de identificadores moleculares únicos (UMI) puede mitigar parte de este sesgo, pero aumenta la complejidad de la preparación y el análisis de la biblioteca [16, 17]. Se pueden utilizar otros enfoques, como la PCR digital de gotas (ddPCR) y el análisis NanoString, para superar las inexactitudes cuantitativas asociadas con la medición de construcciones genéticas diseñadas por ingeniería [18, 19]. El instrumento NanoString nCounter utiliza la hibridación de sondas con códigos de barras fluorescentes para contar copias de moléculas diana en una muestra. ddPCR logra una alta precisión al dividir moléculas individuales en gotitas de emulsión y contar el número de gotitas con y sin amplificación, digitalizando así la PCR y eliminando el sesgo de amplificación del proceso de cuantificación. Sin embargo, los análisis ddPCR y NanoString, aunque son muy precisos, carecen del rendimiento y la resolución que ofrece NGS.

Hemos desarrollado un método novedoso, REcount (Rrestricción minzyme habilitado contaring) para cuantificar etiquetas de secuencia asociadas con construcciones diseñadas que es sencillo de implementar y permite el recuento directo basado en NGS de un número potencialmente enorme de etiquetas de secuencia. En este enfoque, un código de barras de ADN flanqueado por un adaptador de Illumina se libera al digerir con MlyI (una enzima de restricción de tipo IIS que produce moléculas de extremos romos) y secuenciada para contar directamente la abundancia de moléculas molde (Fig. 1a). Demostramos que las mediciones de REcount son susceptibles de multiplexarse ​​mediante el uso de cinco enzimas de restricción ortogonales, un enfoque que probablemente se puede generalizar aún más a otras enzimas.

REcount permite mediciones precisas y precisas de grupos de plásmidos. a Diseño de construcciones REcount. Se libera una construcción flanqueada por el adaptador de Illumina que contiene un código de barras con una enzima de restricción (MlyI) digerir y secuenciar directamente. B Precisión y reproducibilidad del recuento. C Medidas análogas del mismo grupo de plásmidos que se muestran en el panel B utilizando diferentes números de ciclo de PCR. D Desviación cuadrática media de la raíz de los valores esperados (5% por construcción) cuando el grupo de plásmidos se mide usando REcount y ciclos variables de amplificación por PCR de la construcción de código de barras (BC) u otra secuencia variable en estos plásmidos (V4). mi Mapa de calor de correlación de Pearson que compara las mediciones de recuento con datos de PCR digital en gotas y con la amplificación por PCR convencional de los amplicones BC o V4

Usamos REcount para diseñar un conjunto de estándares de ADN sintético que se pueden usar para evaluar el sesgo de agrupamiento debido a la longitud de la molécula en los secuenciadores de Illumina y demostrar que existe una variación sustancial en el sesgo de tamaño entre los diferentes instrumentos de Illumina. Específicamente, las moléculas en las bibliotecas de secuenciación de ADN están sistemáticamente y a menudo sustancialmente sobrerrepresentadas o subrepresentadas en diferentes modelos de secuenciadores de Illumina de una manera relacionada con la longitud de la molécula. Finalmente, evaluamos el impacto del sesgo de tamaño en varias aplicaciones comunes de NGS, incluidas las mediciones transcriptómicas (RNA-Seq [20]), el genotipado de representación reducida (RAD-Seq / GBS [21]) y el perfil de cromatina accesible (ATAC- Sec. [22]).


Clase 17: ADN recombinante 3

Descarga el video de iTunes U o del Archivo de Internet.

Tópicos cubiertos: ADN recombinante 3

Instructores: Prof. Eric Lander

Clase 10: Biología Molecular.

Clase 11: Biologo Molecular.

Lección 12: Biología Molecular.

Clase 13: Regulación genética

Clase 14: Protein Localiz.

Clase 15: ADN recombinante 1

Clase 16: ADN recombinante 2

Clase 17: ADN recombinante 3

Clase 18: ADN recombinante 4

Clase 19: Ciclo / Signo celular.

Clase 26: Sistema Nervioso 1

Clase 27: Sistema Nervioso 2

Clase 28: Sistema Nervioso 3

Conferencia 29: Células Madre / Clon.

Clase 30: Células Madre / Clon.

Clase 31: Médico Molecular.

Clase 32: Evolucion Molecular.

Clase 33: Médico Molecular.

Clase 34: Polimorfo humano.

Clase 35: Polimorfo humano.

Buenos dias. Buenos dias.

No sé ustedes, pero no puedo soportar muchas noches más como esta.

Lo confieso, no he hecho nada en tantas noches seguidas, ¡pero qué juego! ¿Cuántos de ustedes vieron el juego? Excelente.

Muy bien, muy bien. Tienes claras tus prioridades en el mundo. Muy bien. Bueno, si es posible dejar de pensar en Curt Schilling anoche y, lo que es más importante, esta noche.

Quizás podamos pasar un poco de tiempo esta mañana mientras tanto con las neuronas de repuesto que tengas hablando un poco sobre el ADN recombinante, ¿de acuerdo? De lo que hablamos la última vez fue de diferentes formas de clonar su gen en función de sus propiedades. Comenzamos con la clonación por complementación, cierto, la idea de que si tomaba una biblioteca de clones, podría ponerla en bacterias y seleccionar una bacteria cuyo fenotipo se hubiera restaurado en virtud de tener el plásmido. Complementarías el defecto.

Encontrarías el clon que buscabas porque complementaba el defecto.

Eso es genial si puede ponerlo en un organismo que tiene un defecto.

Puedes hacerlo con bacterias. Puedes hacer eso con levadura.

Es más difícil hacerlo con organismos grandes porque no se pueden inyectar suficientes clones de ellos para poder hacerlo práctico, a menos que esté trabajando en cultivo celular o en algún organismo muy pequeño y de rápido crecimiento. Hablamos de poder usar una secuencia de proteínas, traducir de manera inversa esa secuencia de proteínas en la computadora de la secuencia de aminoácidos a la secuencia de nucleótidos, y usar la secuencia de nucleótidos para diseñar una sonda que hibride de nuevo con el genoma. Eso funciona bien si tienes una secuencia de proteínas.

Pero el último tema del que hablamos y que quería tocar de nuevo esta mañana fue suponer que estabas tratando de clonar el gen que causa cierta enfermedad humana y no tienes idea de qué es la proteína. Entonces, no puede usar su secuencia de aminoácidos porque no tiene la proteína. ¿Qué puede hacer cuando todo lo que sabe es que tiene un gen que causa un defecto genético que causa una enfermedad? Y dije que se podía clonar usando las ideas del mapeo genético, la posición, las cosas que desarrolló Sturtevant. Y lo mencioné brevemente, y solo quiero tocarlo un poco más porque algunas personas tenían algunas preguntas al respecto. Y he creado un ejemplo muy simple para mostrárselo. Supongamos que, para facilitar las cosas, estamos trabajando primero en una mosca de la fruta. Estamos trabajando con Drosophila, y supongamos que la imagen real del cromosoma subyacente es así.

Hay un locus que podría tener un alelo mutante M o el alelo de tipo salvaje plus. Hay muchos otros loci a lo largo del cromosoma. Y supongamos que sabemos dónde están y todo eso. Y tienen dos alelos alternativos. En este locus, los alelos son de color naranja o rosa. En este locus llamaré a los alelos naranja o rosa.

Ahora, estos son loci diferentes. Estos son alelos diferentes. Los acabo de llamar naranja y rosa en ambos casos, así que no tengo un arco iris de colores aquí para confundirnos. Pero todo lo que quiero decir es que hay dos alelos posibles aquí, dos alelos aquí, dos alelos aquí.

Este es el gen enfermo que nos interesa y estos son marcadores pasivos. Estos son otros marcadores a lo largo del cromosoma. Si tuviéramos que establecer un cruce entre heterocigotos, un heterocigoto aquí y un heterocigoto aquí, y sucediera que en el cromosoma que lleva el alelo mutante, sucediera que en estos tres marcadores tuviéramos alelos naranjas. No sé qué son, pero sean lo que sean estos alelos naranjas, pueden ser un fenotipo visible, bifurcados o amarillos o erizados. Podrían ser una diferencia en la secuencia de ADN. Podrían ser lo que quieras, pero supongamos que el cromosoma M tiene un conjunto de alelos que son diferentes en cada ubicación que el cromosoma plus. Luego, cuando miramos a la descendencia que sale de esta cruz, solo, en aras de la simplicidad, miremos a la descendencia que son mutantes homocigotos.

Bueno, en general, si no ha habido un cruce aquí, entonces el cromosoma M tendrá naranja, naranja, naranja, naranja, naranja, naranja. Sin embargo, si ha habido un cruce, podría volverse naranja, naranja, rosa en uno de esos cromosomas. O si ha habido cruces como este, podría volverse naranja, naranja, rosa en un cromosoma y naranja, rosa, rosa en el otro cromosoma. Incluso, en el extremo, podría haber tenido cruces muy cercanos al gen, tal vez aquí, e incluso tal vez aquí. Y tienes naranja, rosa, rosa y rosa, rosa, rosa.

Pero si miramos los muchos segregados, por el mapeo genético sabrá que cuanto más cerca esté el locus del gen de la enfermedad, más fuertemente correlacionada estará la herencia, más estrecha será la vinculación. Esto no es más que un mapeo de vínculos. Pero ahora, supongamos que estuviéramos haciendo un mapeo de ligamiento, pero por el bien del argumento, ya se había secuenciado todo el genoma. Supongamos que se ha secuenciado el genoma en un cruce, y se ha secuenciado todo el genoma de la mosca de la fruta que se ha secuenciado.

Y miramos una cruz y miramos a los mutantes.

Y lo que hicimos fue probar diferentes posiciones a lo largo del genoma.

Y en cada posición, teníamos algún marcador genético.

Y ese marcador genético podría ser tan simple como el hecho de que en esa posición, tal vez haya una A en la secuencia de ADN en uno de los cromosomas, y tal vez no conozca una G en la otra secuencia.

Y aquí, este marcador podría ser, hay una T en una posición particular, y hay una C en alguna posición particular.

Si pudiéramos ensayar eso, si pudiéramos decirlo, podríamos ver si esta variación de ortografía está estrechamente correlacionada con el mutante.

Y esta variación ortográfica está estrechamente relacionada con la herencia del alelo mutante. Y podríamos simplemente probar arriba y abajo del genoma, diferentes sitios de diferencia de ortografía como si fueran marcadores genéticos en nuestro cruce porque son marcadores genéticos en nuestro cruce, y ver cuál está más estrechamente correlacionado.

En el momento en que obtenemos cualquier diferencia en la secuencia genética, que muestre un enlace de co-herencia en este cruce, sabemos que este punto en el genoma debe estar cerca de nuestra mutación.

Entonces, probaremos uno más cerca y probaremos uno en el otro lado.

Y lo que hace es probar los sitios de variación genética, primero para encontrar uno que muestre alguna co-herencia.

Y una vez que lo tienes, prueba los más cercanos y más cercanos. La última vez hablé sobre el proceso de, si tuvieras uno de esos marcadores, podrías usarlo para aislar el siguiente clon y el siguiente clon y el siguiente clon. ¿Pero sabes de lo que me di cuenta? Eso es tan anticuado. También podríamos ocuparnos del hecho de que tenemos una secuencia del genoma. Nunca más aislarías el siguiente clon y el siguiente clon y el siguiente clon.

Basta con buscarlo en la computadora. Entonces, incluso si tiene la secuencia completa del genoma, tenemos que averiguar qué parte de él se co-heredó junto con esta enfermedad, y esa es la forma en que lo hace, ¿de acuerdo? El mapeo genético, tal como lo inventó Sturtevant, se puede aplicar si se tiene una secuencia completa del genoma y suficientes sitios de variación. Y lo dibujé para un cruce de moscas de la fruta, pero esto también podría ser fibrosis quística.

La única diferencia es que si estamos haciendo esto en familias humanas y es fibrosis quística, no tenemos tanta descendencia.

Entonces, tenemos que agrupar datos de muchas familias. Y no podemos arreglarlo para que cada familia tenga exactamente los mismos alelos naranjas aquí arriba y alelos rosados ​​allá abajo, pero las computadoras pueden lidiar con eso. Todavía pueden descubrir la correlación entre muchas familias, y usted encuentra el lugar en el genoma donde, para muchas, muchas, muchas familias, los niños que contrajeron la enfermedad muestran una herencia correlacionada con este marcador. Y eso eventualmente lo ubica en una región del genoma. Te fija en esos marcadores genéticos que muestran la correlación más estrecha absoluta, la correlación más estrecha, y ahí es donde miras.

Y de esa manera, la gente pudo mapear la ubicación de la enfermedad de Huntington en 1984 para, a estas alturas, mapear las ubicaciones de más de 1, 00 diferentes enfermedades genéticas humanas donde la gente no conocía la proteína de antemano. Lo hicieron completamente en base a este mapeo posicional. Entonces, la idea de Sturtevant, que me gusta tanto, se ha desarrollado de manera tan hermosa ahora en el área de la medicina molecular moderna. está bien. Entonces, adelante.

Quiero hablar sobre algunas otras variaciones sobre el tema con bastante rapidez, y luego creo que quiero hablar sobre cómo analizas tus clones. Primero, variaciones sobre la clonación, al menos debería mencionarlo. Hablamos de la clonación en un plásmido de replicación autónoma en una bacteria.

Entonces, vas a una bacteria. Tienen algunas piezas de ADN replicadas de forma autónoma. Hay círculos. Puede clonar en ellos, y normalmente puede, estas cosas están en el orden de, no sé, 1000 a 2000 a 5000 bases se pueden clonar fácilmente en estos plásmidos. Puede hacer más, pero ese tipo de número típico es el tamaño de la inserción, por lo general. Pero nosotros en el laboratorio subimos a números mucho más altos como 10,000 a veces. También puede, si quisiera estudiar la levadura, resulta que la levadura felizmente también tiene plásmidos, y puede hacer algo similar con la levadura.

Resulta que en lugar de usar plásmidos, puedes usar virus bacterianos. Estos virus bacterianos tienen todas las formas diferentes de las que hemos hablado, circulares o lineales, y por lo general pueden contener, oh, 15, 00-40,000. Algunos de estos virus son bastante grandes.

El bacteriófago lambda tiende a transportar muchas cosas.

Y puede replicarse. Entonces, podrías hacer lo mismo con eso. Incluso puede usar virus que infectan células de mamíferos y ahora hay todo tipo de virus que las personas clonan de nuevo, lineales o circulares. No lo sé, para las células de mamíferos, a menudo, los virus como 1000-5, 00. Incluso puedes hacer cromosomas completos artificiales ahora. Puedes hacer esto en levadura.

Los cromosomas artificiales se denominan YAC. Tienen toda la pequeña maquinaria, pequeños telómeros, pequeños centrómeros. Tienen un marcador seleccionable, y luego puedes clonar en él tu fragmento de ADN. Y estos pueden tomar hasta un millón de bases de ADN.

Entonces, si quisiera, hay cromosomas artificiales bacterianos.

Se llaman BAC si están en bacterias. Y recientemente, la gente ha desarrollado sistemas de cromosomas artificiales para células de mamíferos, y específicamente células humanas. Y, lamentablemente, se llaman MAC y HAC y cosas así. Básicamente, cualquier molécula que pueda replicarse en cualquier sistema, algún biólogo molecular inteligente vendrá y dirá, ¿cómo puedo usar eso para mi propósito, para pegar mi ADN y lograr que se replique en este organismo?

Entonces, si algo no está en esta lista, lo estará pronto, ¿de acuerdo? Ahora, aquí hay otra cosa. Se trata de clonar trozos de ADN.

Solo para tener el fragmento de ADN en una biblioteca, pero supongamos que queremos hacer más que tener el ADN en la bacteria, supongamos que lo que realmente me gustaría hacer es tomar una bacteria, E. coli, y ponerla en trabaja para nosotros. Quizás lo que me gustaría hacer es tomar un plásmido e insertar en ese plásmido el gen de la insulina humana.

Entonces, voy a tomar el locus de ADN correspondiente a la insulina humana, clonarlo en mi plásmido. Tal vez lo haya aislado de mi biblioteca porque, veamos, se conoce la secuencia de la proteína de la insulina para poder traducirla a la inversa a una secuencia de nucleótidos. Entonces, podría probar una biblioteca.

Entonces, pude encontrar el clon que tiene insulina. Ahora, lo que me gustaría hacer es persuadir a esta bacteria no solo para que lleve el ADN, sino para que produzca insulina para mí. ¿Sería útil eso? Sí, ¿cómo solía la gente obtener insulina? Cadáveres, cadáveres, sería mucho más fácil obtenerlos de un fermentador, cierto, obtener insulina de un fermentador, si pudieras pedirle a E coli que lo produzca.

Entonces, si lo ponemos en E. coli, ¿producirá insulina para nosotros?

Aquí está el locus humano, el ADN de la insulina. ¿Producirá insulina? Veamos, ¿cómo se hace una proteína?

Tienes que empezar por hacer ARN, ¿verdad? Tienes que transcribir el gen. ¿Transcribirá E. coli este gen?

¿Bien por qué? Tiene un promotor, ¿verdad? Tiene el promotor de insulina. Aquí vamos. El promotor de insulina está aquí.

Entonces, ¿E coli se unirá al promotor de insulina y comenzará a producir ARN? No, resulta que los promotores en humanos y los promotores en bacterias son suficientemente diferentes. No funcionan en todas las especies.

No reconocerán al promotor humano. Demasiado. ¿Algunas ideas?

¿Sí? Pegue allí un promotor bacteriano. Bien, estás actuando como un buen diseñador de biología molecular aquí. Pongamos aquí un promotor bacteriano.

Reconocerá a su propio promotor. Eso es genial. Entonces, pongamos aquí el ADN del gen de la insulina humana. Y ahora, tal vez pongamos el operón Lac, y cuando tenga lactosa comenzará a producir ARN a partir del gen de la insulina humana. Y empezará a traducirlo.

Y obtenemos insulina. ¿Algún problema? Bueno, ¿hará alguno, para empezar? ¿Qué otro aspecto de los genes de mamíferos es diferente de los genes bacterianos?

Procesamiento, ¿qué tipo de procesamiento con el ARN? Y el empalme, ooh, el gen de la insulina tiene intrones que deben empalmarse.

Entonces, esto va a producir algo de ARN, ARN de insulina, y debe procesarse de esta manera. ¿Continuarán las bacterias empalmando por nosotros? No hacen empalmes. ¿Sí? Bueno, esa es una pregunta muy interesante porque no lo hemos hecho. Pero, ¿qué propones? Verá, acabo de tomar un fragmento de ADN humano del genoma humano, que codifica los intrones y los exones. Pero, parece que tiene una solución a nuestro problema, ¿y cuál sería? Entonces, en lugar de hacer una biblioteca de ADN genómico, lo que está sugiriendo es una idea radical.

En su lugar, tomemos el ARN humano. Aquí hay algo de ARN humano, mucho ARN humano, una gran colección de ARN humano. Lo que estaba al final del ARN humano: una cola de poli (A). Y lo que entiendo que está sugiriendo es que si tomamos ARNm humanos, una colección completa de ellos, quiere que convierta estos ARNm de nuevo en ADN y los clone en lugar de usar el ADN cromosómico. ¿Cómo convierto un ARN en ADN?

¿Es eso posible? Qué usas: transcriptasa inversa.

Tenemos que darle una imprimación. Así que recuerde, cinco primos a tres primos, nos gustaría poner una cartilla aquí.

¿Alguna idea para una buena cartilla? Poly (T), ¿no es eso conveniente?

Una de las razones por las que los mensajes de los mamíferos tienen colas poli (A) es para que podamos transcribirlos de forma inversa utilizando cebadores poli (T). No, eso en realidad no es cierto. Entonces, usamos transcriptasa inversa. Y lo que podemos hacer es copiar este ARN en una hebra de ADN. Aquí vamos.

Entonces, lo que haremos, el siguiente paso, es tomar el ADN y lo copiaremos en una segunda hebra de ADN.

Y ahora, tenemos ADN de doble hebra cuya secuencia coincide con los ARNm ya procesados. ¿Perdón? Entonces, las secuencias coincidirían con los ARNm. Entonces, lo que podría hacer es, en lugar de tomar ADN humano del núcleo, podría tomar ARN, convertirlos de nuevo en ADN mediante transcriptasa inversa y crear una biblioteca ahora que consta de millones de insertos, cada uno de los cuales tiene lo que se llama ADNc, un ADN copiado, copiado de nuevo del ARN. La gran ventaja de esto es que la célula humana ya ha realizado el empalme, por lo que no quedan intrones. Ahora, cuando lo pones en una bacteria, la bacteria puede expresar esto. Si le da su propio promotor bacteriano, es capaz de producir ARN.

Y si no le pide a la bacteria que tenga que empalmar, si simplemente le da una pieza de ADN previamente empalmada que no necesita empalme, puede traducir ese ADN. Ahora, observe que usamos todos nuestros trucos. Tenías que saber sobre la transcriptasa inversa, las colas poli (A), las estructuras de los genes, los intrones, los exones, sí, ¿pregunta?

No es así. Haces esto en el tubo de ensayo. Purifica el ARNm humano en el tubo de ensayo. Usted toma ese ARNm en un tubo de ensayo, agrega transcriptasa inversa, agrega poli (T), hace que esta reacción de ARN a ADN en el tubo de ensayo regrese.

¿De dónde viene? Virus que se copian a sí mismos para ganarse la vida, ¿verdad? Entonces, nuevamente, todo lo que estamos usando proviene de algún organismo vivo que hace este tipo de cosas. Y, cuando les enseño los hechos de cómo se replican los virus o cómo se ve la estructura de los ARNm o lo que sea, es porque cada bit de conocimiento que obtenemos sobre la forma en que funciona la biología se convierte en una herramienta increíblemente poderosa a medida que nos está resultando realmente poder estudiar más biología. Que bien. Entonces, ¿de dónde viene la transcriptasa inversa ahora? Originalmente provienen de virus que regresan del ARN al ADN. Ahora bien, ¿cómo se obtiene la transcriptasa inversa? Catálogo, correcto, muy bueno. Muy bien, esto se llama, finalmente, una biblioteca de ADNc. Y, si hubiera creado una biblioteca de ADNc, podría examinar la biblioteca de ADNc para encontrar el gen de la insulina.

¿Es esto útil? Esta pasa a ser, por ejemplo, una de las consecuencias de esto fue la industria de la biotecnología. De acuerdo, si tiene alguna duda sobre la utilidad de comprender estas cosas abstractas sobre E. coli y bacterias y cosas por el estilo, una de las consecuencias fue Genentech, Biogen y Amgen, y si simplemente camina por Kendall Square, dentro de un milla de este lugar verá expuestas ante usted las consecuencias de esta habilidad, ¿de acuerdo? Está transformando Cambridge. ¿Sí?

Y el mundo. Sí. En efecto.

Podría ser que producir grandes cantidades de insulina fuera perjudicial para las bacterias porque habría tanta proteína que se aglutinaría y mataría a las bacterias. Puede ser que la insulina, por varias razones, no se pliegue adecuadamente en el ambiente bacteriano.

Y esta es la razón por la que la industria de la biotecnología tiene mucha gente inteligente trabajando en ella porque usted tiene toda la razón. Puede decidir que en lugar de clonarlo en bacterias, es mejor clonarlo en alguna célula de insecto en cultivo con la que, de hecho, a la gente le gusta trabajar, o alguna otra célula, o una célula de mamífero. Entonces, simplifico diciendo que lo pongan en coli, pero de hecho eso podría probar seis líneas celulares diferentes, seis posibilidades de hospedadores diferentes.

Puede que tengan que sacar la insulina y volver a doblarla in vitro y cosas así. Tienes toda la razón.

En realidad, esto es algo que requiere trabajo para hacerlo bien, al igual que construir un avión requiere trabajo.

Podría decirles los principios de Bernoulli, pero luego Boeing hace más que simplemente escribir los principios de Bernoulli.

OK, así que adelante. Ahora, me gustaría pasar a analizar su clon.

Analizando el clon, supongamos que lo tenemos, tal vez sea por clonación posicional, tal vez sea por clonación de ADNc, pero de una forma u otra tenemos un clon que nos interesa mucho.

Quizás tenga el gen de la insulina. Quizás tenga el gen de la enfermedad de Huntington. Sea lo que sea, vamos a querer estudiarlo.

Y por el momento, no les he dicho cómo leería su secuencia de ADN o analizaría su ADN. Entonces, el primer paso es, por supuesto, tengo que purificar el plásmido. Y resulta que eso se puede hacer.

Existen técnicas bioquímicas simples, como mencioné en una conferencia anterior, que te permiten hacer crecer muchas bacterias, abrirlas y hacer que el plásmido sea un pequeño círculo, y que esté un poco más enrollado y enrollado. tiene propiedades físicas algo diferentes. Y puedes usarlos para purificar el plásmido. Por lo tanto, las preparaciones de plásmidos no son difíciles de hacer. Puede obtener una colección bastante pura del plásmido.

Ahora, supongamos que he hecho esto para, oh, no sé, tomemos mi primer ejemplo, mutantes naranjas. Supongamos que traté de rescatar bacterias que eran de color naranja negativo, y supón que descubrí que 50 plásmidos diferentes rescataron mi mutante naranja porque transformé muchos plásmidos, los coloqué en placas y crecieron 50 colonias.

¿Son todos iguales o son diferentes?

¿Hay alguna forma rápida de echar un vistazo a estos 50 plásmidos y ver si son idénticos o bastante cercanos, o obviamente diferentes? Bueno, me gustaría tomar alguna forma de tomar el ADN del plásmido y analizarlo fácilmente. Es posible que desee ver, como, ¿qué tan grande es el inserto? Bien, esa sería una forma, si tuvieran insertos de diferentes tamaños para que no pudieran ser lo mismo.

Entonces, tal vez lo que podría hacer es cómo clonar esto. Usé sitios EcoRI que recuerdo. Entonces, tengo sitios EcoRI aquí. Supongamos que tomara este ADN y ahora cortara el ADN del plásmido con EcoRI.

Entonces, lo que obtendría son dos moléculas separadas.

Obtendría el vector y el inserto. ¿Cómo pude ver lo grandes que eran? Geles, electroforesis en gel es la forma de hacerlo. Entonces, tomo un gel. Un gel es una losa de gelatina, gelatina, está bien, y normalmente está plano, pero lo voy a hacer verticalmente aquí. Carga en la parte superior aquí un poco de mi ADN, toda esta mezcla. Tomo el plásmido. Lo corté. Lo puse aquí. ¿Carga positiva o carga negativa del ADN? Negativo. Entonces, ¿dónde debería poner el tirón positivo? En la parte de abajo, bien hecho.

A menudo, eso no se hace y en detrimento del experimento.

Si pones el tirón positivo aquí, va por el camino equivocado, y todo el mundo tiene que hacerlo al menos una vez. Entonces, lo que sucederá es que los fragmentos de ADN se muevan y los fragmentos más pequeños se muevan más rápido que los grandes, ¿verdad? Si algo es pequeño, se moverá rápido. Si algo es grande, se mueve lentamente: pequeño, grande.

El más pequeño se mueve más rápido porque se mueve mejor a través de los poros pequeños del gel. Entonces, supongamos que tuviera que hacer esto para un montón de plásmidos, y lo que vi fue esto.

Primer orden, ¿qué adivinas? ¿Perdón? La carretera superior probablemente sea el vector plásmido. Este es probablemente el vector, y ¿qué sé yo sobre las inserciones? Al menos dos inserciones, al menos dos inserciones distintas. Ahora, si quisiera estar seguro de que ese era el vector, tal vez lo que podría hacer es tomar otra fila y ejecutar una cantidad conocida del vector, tomar el vector solo y podría verificar que el vector solo se ejecuta aquí. Y tal vez podría tomar algunas otras moléculas conocidas. Estos se denominarían patrones de peso molecular. Entonces, si ejecuto algunos datos conocidos en uno de los carriles del gel, incluso puedo medir y decir, ah-ha, el inserto está en algún lugar entre el tamaño de este y el tamaño de aquél. Y así, obtengo una pequeña regla que puedo poner en el gel. Entonces, de hecho, eso es lo primero que harías es digerir tu clon de esa manera.

Ahora bien, ¿el hecho de que estos tipos tengan exactamente el mismo tamaño en el gel, aparentemente, significa que son exactamente la misma pieza de ADN? No, porque ni siquiera puedes decir que es exactamente lo mismo.

Hay un límite en la precisión con la que se puede medir.

Entonces, ¿qué más podrías hacer? Podría probar con otra enzima de restricción. Resulta que como hay tantas enzimas de restricción en el catálogo, si tomo un trozo de ADN, tal vez ese fragmento Eco, podría intentar cortarlo con HinDIII.

Y cuando lo corte con HinDIII, obtendré tres longitudes distintas. Podría intentar cortarlo con, oh, no sé, elegir otra enzima, BamHI. Cuando lo corte con BamHI, obtendré otras longitudes. Y cómo obtener estas longitudes añadiéndolas, aplicándolas en un gel y observando sus tamaños.

¿Qué pasa si agrego HinDIII y BamHI a mi tubo de ensayo?

Cortaría en ambos sitios. Entonces, cortaría aquí, aquí, aquí, aquí, aquí. Entonces, esto se corta con HinDIII, aquí se corta con BamHI, aquí se corta con ambos y pude medir estas longitudes. Entonces, suponga que le di esto como un problema de computadora, tengo una cuerda y es una cuerda desconocida, y la corto en dos lugares y obtengo estas longitudes, X1, X2, X3. Y luego tomo esa misma cuerda y la corto en otras posiciones, Y1, Y2 e Y3 son las longitudes que resultan. Y luego suponga que ahora lo corto en ambos sitios, lo mido y obtengo Z1, Z2, Z3, Z4, Z5. Si le di todos esos números, ¿podría averiguar dónde deben estar los sitios? Probablemente. Resulta ser un problema informático razonablemente factible, aunque puede complicarse un poco en algunos lugares. Y podría probar una tercera enzima y una cuarta enzima, y ​​es un lindo ejercicio escribir un pequeño fragmento de código que determinará dónde se encuentran los sitios en función de las longitudes. La razón por la que ocasionalmente se vuelve gracioso es si Z3 y Z4 tienen exactamente la misma longitud y se encuentran uno encima del otro en el gel, y hay casos especiales.

Pero puede reconstruir dónde deben estar esos sitios de restricción simplemente escribiendo una buena pieza de código que unirá estas piezas. Esto se llama mapeo de restricciones y es muy divertido. A todo el mundo le gusta hacer esto una vez.

Pero, es solo una cantidad limitada de información, cierto, porque llegas a donde están los sitios, y supongo que si te di diez clones y todos tuvieran exactamente los mismos mapas de restricción, las mismas posiciones exactas de estos sitios de restricción, tú ' Me sentiría bastante seguro de que eran el mismo clon.

Pero todavía no sabrías mucho sobre el clon aparte de que tenía dos sitios HinDIII y dos sitios BamHI, y aquí es donde estaban.

¿Qué es lo que realmente desea saber sobre este clon? Es una secuencia de ADN, ¿verdad? No nos conformemos con nada menos que la secuencia exacta de nucleótidos del clon. Entonces, ese es realmente el último tema clave es la secuenciación del ADN.

¿Cómo vas a secuenciar el ADN? Bueno, supongamos que le doy una doble hebra de ADN, cinco primos a tres primos, cinco primos, tres primos, ADN de doble hebra.

Déjame calentarlo. ¿Qué pasa cuando caliento el ADN?

Derrite los enlaces de hidrógeno, los enlaces de hidrógeno no covalentes aquí se rompen y separé mis dos hebras. Ahora, lo que me gustaría hacer es empezar a leer esta secuencia de ADN.

Entonces, voy a hacerme una cartilla. Caramba, aquí hay un manual.

Vas a preguntarme, ¿cómo supe qué cebador usar si no conozco la secuencia de ADN? ¿Cómo puedo hacer una imprimación?

Mantenga esa pregunta. Asegúrate de recordar volver y responder eso, ¿de acuerdo? Pero por el momento, concédeme que tengo una cartilla aquí.

Lo que me gustaría hacer es agregar ADN polimerasa. Entonces, agreguemos algo de ADN polimerasa. Y me gustaría agregar nucleótidos trifosfatos, dNTP, dATP, dCTP, dGTP, dTTP, y si agrego ADN polimerasa y agrego mis nucleótidos, ¿qué nos dice Arthur Kornberg que sucederá? Comenzará a polimerizar, ¿verdad? Y se detendrá ahí. Entonces, la polimerasa conoce las bases, ¿verdad? Sabe qué base poner porque la polimerasa es muy inteligente.

Entonces, las bases se colocan correctamente. El único problema es, ¿cómo conseguimos que la polimerasa nos diga lo que acaba de hacer?

Aquí tienes un lindo truco. Este es, por cierto, un lindo truco que ganó el Premio Nobel. Entonces, supongamos que mi cebador es así: cinco primos, T, A, A, T, T, C, T, y la hebra de plantilla aquí, A, T, T, A, A, G, A, ahora sigamos adelante. , A, T, G, C, C, A, A, T, G, G, A, T, T, A, cinco primos. Entonces, ahí está mi manual.

Ahí está mi plantilla. Voy a empezar a agregar. Bueno, agreguemos nuestra polimerasa. Agreguemos nuestros dNTP, polimerasa, dATP, dCTP, dTTP, dGTP, y luego quiero agregar un ingrediente antiguo extra bueno especial en esto.

El ingrediente adicional especial que quiero agregar es una T defectuosa, un dTTP defectuoso. ¿Qué quiero decir con defectuoso? Me refiero a modificado químicamente de tal manera que no se puede extender, que no se puede extender más allá de él. Así que ahora, sigamos mi reacción.

Voy a empezar con, sólo los voy a escribir aquí, T, A, A, T, T, C, T. ¿Cuál es la siguiente base que voy a poner?

T, ¿de acuerdo? ¿Es una T defectuosa o una buena T? No sé.

Podría ser. Tal vez sea una T defectuosa, que pondré una pequeña estrella allí, ¿de acuerdo? Si es así, ¿qué pasa con mi polimerasa?

Para. No puede ir más lejos. No puede ir más lejos porque la T está defectuosa. Pero, ¿y si no fuera una T defectuosa?

¿Y si fuera una buena T? Entonces, ¿qué pasa? La polimerasa se pondrá, sigan adelante, muchachos. A, C, G, G, ¿y qué pone ahora? T, ¿verdad? Ahora, ¿es eso una T defectuosa? Quizás. No lo sabemos.

Si es una T defectuosa, se detiene allí. De lo contrario, la polimerasa va aquí, ¿y el siguiente espacio es qué?

T, ¿y es eso un T defectuoso? Quizás.

Y, si no es una T defectuosa, entonces la polimerasa continúa, coloca una A, coloca una G, una C, C y luego una T.

Y tal vez eso sea defectuoso. Muy bien, ¿cuál de estas posibilidades es lo que hace la polimerasa cuando la agrego?

Bueno, todos ellos. Hay muchas moléculas ahí.

Algunas de las moléculas, por casualidad, instalan una T defectuosa, y se detienen aquí. A veces, se pone una buena T y las moléculas se detienen aquí. A veces se detienen aquí, y si comienzo con una gran colección de cebadores en una gran parte de mi plantilla de ADN, obtendré toda esta colección de diferentes moléculas de diferentes longitudes. ¿Qué longitudes obtengo?

Las longitudes corresponden precisamente a las posiciones de los "Yoes".

Obtengo una serie de moléculas cuyas longitudes coinciden perfectamente con las posiciones de Ts. Bueno, en primer lugar, ¿cómo mido sus longitudes? Ejecute un gel, bingo, ejecute un gel.

Entonces, si pudiera ejecutar un gel que pudiera separar nucleótidos en función de la longitud de dos uno al lado del otro, otro allí arriba, vería una molécula pequeña, de uno, dos, tres, cuatro, cinco, tres, seis, de longitud. ocho, vería uno de longitud ocho. Vería uno de longitud, cuál es el siguiente, 13, ocho, nueve, diez, 13, 14, entonces ocho, nueve, diez, 11, 12, 13, 14, 15, qué es eso, 13, 14, 15 , 16, 17, 18. Bien, esas serían las posiciones en las que vería esta T. Entonces, necesitaría tener un tipo especial de gel que sea tan preciso que pueda separar nucleótidos individuales, correcto, que las longitudes , pero eso se puede hacer.

Está la acrilamida, el polímero que lo hará.

Eso me dirá la longitud exacta de las T. ¿Qué más puedo hacer?

Bueno, obviamente hagámoslo desde las otras bases.

Probemos defectuoso A, defectuoso C, defectuoso G.

Veamos, si lo hice bien, lo que intentaremos, debería terminar luciendo algo así. Y si no, te haces una idea de que esto debería coincidir en cuanto a qué columnas tienen qué longitudes.

OK, creo que lo hice bien. Eso me dice las longitudes de las moléculas. Entonces, pude leer en secuencia.

La secuencia de esa molécula debería ser, comenzando desde allí, la secuencia de lo que he agregado, debería ser algo como T, A, C, G, G, T, T, A, C, C, T, sí, funcionó.

Es exactamente correcto. Bingo. Ahora puedo leer la secuencia.

Fred Sanger, un científico brillante, ideó este método de simplemente explotar la propia polimerasa de E. coli o las propias polimerasas de otros organismos.

Entonces, copiar y toda la química que había que hacer era pensar en un nucleótido defectuoso que no se podía extender.

Obviamente, podría insertarse. No se puede extender. Entonces, una pregunta es, ¿qué es un nucleótido defectuoso? Bueno, recordará que nuestro nucleótido en la cadena de fosfato de azúcar está sentado así. Veamos, colgar del carbono principal es la base. Este es el carbono principal uno, el carbono principal dos, el carbono principal tres, el carbono principal cuatro, el carbono principal cinco. ¿Qué sabemos en el ADN de los dos carbonos principales?

Normalmente en la ribosa habría un hidroxilo aquí, ¿verdad? Pero en la desoxirribosa, solo hay un hidrógeno.

Entonces, si esto es desoxirribosa, entonces un dNTP realmente significa una desoxirribosa de dos primos, ¿dónde coloco ahora mi siguiente base en el tren de fosfato de azúcar? Tres extremos principales, y a qué lo adjunto: al OH.

¿Qué crees que pasaría si no hubiera un OH ahí?

Estas atorado. Todo lo que tienes que hacer es quitar ese hidroxilo.

Sin grupo hidroxilo. Si fabricó nucleótidos que no tienen ese grupo hidroxilo, no se pueden extender.

Entonces, en lugar de ser solo desoxi en las dos posiciones principales, son didesoxi, desoxi en dos posiciones.

Son dos didesoxinucleótidos primos, tres primos.

Eso es todo. Ahora, si necesita obtener dos didesoxinucleótidos primos tres primos, están en el catálogo, por supuesto, porque Fred Sanger tuvo que hacerlos él mismo y todo eso, pero puede comprarlos ahora. Y así, puedes hacer la secuencia.

Sin embargo, algunos otros pequeños detalles aquí, chicos.

¿Cómo vemos el ADN y el gel? Una posibilidad sería mancharlo. Hay algunos troqueles como el bromuro de etidio, y para hacer su mapeo de restricción, usar un tinte que se adhiere al ADN como lo hace el bromuro de etidio es bastante bueno. Y luego lo pones bajo luz fluorescente y miras. Para la secuenciación, la cantidad de ADN es tan pequeña que es difícil de ver con un tinte a simple vista, que es lo que se hace con el mapa de restricción. ¿Lo siento mucho?

Entonces, lo primero que hizo la gente fue radiactivo. Lo que hicieron fue que tomaron un cebador, lo hicieron radioactivo y tú hiciste toda esta reacción de secuenciación con un cebador radioactivo.

Luego, cuando ejecutas el gel, tomas tu gel y lo expones durante algunas horas, quizás ocho horas, un trozo de película de rayos X, revelas la película de rayos X y verás esa imagen. Entonces, una solución que podría hacer para visualizar es usar nucleótidos radiactivos. Entonces, obtuvimos el nucleótido defectuoso.

Ahora necesitamos visualizar nuestro ADN. Visualicemos la secuencia.

Una posibilidad: radiactiva. La segunda posibilidad, alguien ya la mencionó, un tinte fluorescente.

Ahora, aquí, se podría poner un tinte fluorescente y no se puede leer con el ojo, pero los láseres son muy buenos para leer.

Por lo tanto, puede ejecutar un gel completo aquí y hacer que los láseres lo escaneen.

Pero, en realidad, puedes hacerlo mejor que eso. Supongamos que pongo mi tinte fluorescente en mis didesoxinucleótidos.

Supongamos que lo pongo en mis didesoxinucleótidos, y supongamos que incluso tuviera suficiente química a mi disposición para poder poner un color diferente de tinte fluorescente en cada uno de mis nucleótidos. Entonces, siempre que se coloca el didesoxi para terminar la cadena, lleva consigo su propio color.

¿No sería genial? Y eso es lo que está hecho. No solo puede comprar didesoxinucleótidos ahora, sino que puede comprar los cuatro didesoxinucleótidos diferentes, cada uno con su propio tinte adherido.

Entonces, hay di-didesoxias, supongo, lo siento, pero son diferentes, ¿verdad? Son tinte-didesoxis. Entonces, podrías hacer eso.

Y luego lo que obtienes es que en esta columna obtienes este color.

Y en esta columna, obtendría este color. Y en esta columna obtendrías este color, etc. No me preocupo por dónde están aquí. Y todos serían de diferentes colores y sería muy bonito. ¿Sabes que? ¿Por qué tenemos que seguir corriendo carriles separados? Si tenemos un láser, podemos decirle al láser que lo escanee para que lo diga diferente. Pégalo de una manera. De hecho, lo que se hace es meterlo en un tubo capilar, echar los cuatro al mismo tiempo ahora, y a medida que van pasando estos fragmentos, cada uno tiene su propio color. Y todo lo que necesitamos es un escáner láser capaz de colocarse aquí mismo. Aquí está mi escáner láser. Y el escáner láser, positivo aquí, negativo aquí, a medida que el ADN fluye a través de este polímero, el escáner láser lee qué colores acaban de pasar.

Y va color A, color C, color T, color G. Eso es todo. Entonces, en realidad, ahora hay máquinas que tienen 96 capilares diferentes.

Estos se llaman tubos capilares. Y puede tener 96 de ellos con escaneo láser, y en cada columna ahora, resulta que puede leer casi 1,000 letras, 1,000 bases por columna por capilar multiplicado por 100 capilares.

O en otras palabras, puede leer alrededor de 10 ^ 5 bases de información.

Puede leer 10 ^ 5 bases de información en aproximadamente dos horas.

Por supuesto, puede hacerlo diez veces al día. Por lo tanto, puede leer 10 ^ 6 o aproximadamente un millón de bases de información por máquina. Y aquí en el MIT, tenemos 100 de estas máquinas. Entonces, en realidad podemos leer un poco menos de 100 millones de letras de secuencia de ADN por día, lo que quiero decir es mucho.

Leemos alrededor de 40 mil millones de cartas al año aquí en el MIT, y así es como lo hacemos. ¿Cuánto cuesta una máquina?

Lista, o quieres un trato? Tienen un precio de $ 300, 00, pero si compras al por mayor, puedo hacerlo mejor. [RISAS] Por cierto, lo compramos al por mayor. Así que ahora, ¿cómo vamos a llevar nuestra cartilla allí? Eso fue lo único que nos faltaba, ¿de dónde vino nuestra cartilla? El último pequeño detalle: aquí está mi vector, recuerde, y quiero secuenciar este inserto.

¿Cómo voy a colocar una imprimación en el inserto? No sé cuál es su secuencia. ¿Cómo empiezo esto? ¿Perdón? Bueno, pero eso no me dirá cuál es la secuencia que tengo que hacer, quiero decir, estaba buscando tratar de obtener una cartilla que coincida con el inserto.

Y no sé qué es el inserto. Entonces, ¿cómo voy a obtener una cartilla?

Oh, conozco el vector. El vector es bien conocido.

Su secuencia está en el catálogo. En su lugar, permítanme usar un cebador que se sienta en el vector, y para empezar, compararé con una secuencia conocida, y luego secuenciaré en mi territorio desconocido. Entonces, así es como obtiene el cebador inicial si organiza que su cebador inicial esté sentado en una secuencia de vector conocida. Muy bien, ahora puedes secuenciar el ADN. Tengo que decir que he enseñado este curso durante un poco más de una década, y poder decir que ahora podemos secuenciar rutinariamente alrededor de un millón de letras por máquina, y 100 millones de letras por día, y cosas como esta. no era habitualmente el caso. Cuando comenzamos a impartir este curso, estaba describiendo lo que dijimos.


Discusión

La expresión de proteína recombinante soluble sigue siendo un cuello de botella para los proyectos de genómica estructural y funcional que estudian proteínas humanas. Demostramos aquí un método para generar y caracterizar un gran conjunto de clones de expresión para proteínas humanas a partir de una biblioteca de ADNc, produciendo una preselección de clones para la expresión a gran escala. Al hacer coincidir las secuencias de clones con la base de datos Ensembl, se demostró que se encontraron clones de expresión con productos solubles para 1.509 proteínas humanas correspondientes a 1.105 genes distintos. Para cubrir un conjunto más grande de proteínas con nuestro enfoque, podrían usarse bibliotecas adicionales de diferentes tejidos y etapas de desarrollo.

Se encontró que el 36% de los clones de expresión son clones de ORF completo que expresan proteínas humanas completas, mientras que los clones restantes expresan fragmentos carboxi-terminales. Cabe señalar que debido a que la base de datos Ensembl se genera automáticamente y las posiciones de los codones de inicio aún se desconocen para muchas transcripciones humanas, este número es inexacto y probablemente será mayor. Las versiones futuras de Ensembl se beneficiarán de los esfuerzos en curso para generar y anotar secuencias de ADNc de longitud completa humana [21], y la información sobre las posiciones de inicio de ORF debería mejorar en consecuencia.

Hay varias razones para la presencia de clones que expresan fragmentos carboxi-terminales. Una cierta proporción de insertos incompletos es una característica común de las bibliotecas de ADNc construidas mediante la técnica de clonación utilizada aquí. Además, los clones de ORF completo que contienen partes de la región 5 'no traducida (UTR) no se detectan en nuestra pantalla de expresión si la UTR contiene codones de parada. El hecho de que las proteínas o fragmentos más pequeños a menudo se expresan mejor que las proteínas muy grandes en E. coli podría ser otra razón por la que se obtuvieron muchos clones que expresan fragmentos carboxi-terminales.

Generalmente se requieren clones de ORF completo para la determinación de estructuras de proteínas. Sin embargo, los fragmentos carboxi-terminales pueden ser interesantes para otras aplicaciones, como el análisis estructural del dominio por espectroscopia de RMN.

Como ejemplo de la aplicación de la biblioteca de clones caracterizados, mostramos la selección de clones para análisis de estructura. El cribado de alto rendimiento para los clones de expresión tomó aproximadamente un año, mientras que el trabajo sobre las 163 proteínas seleccionadas aún está en progreso y se están purificando proteínas adicionales. De las 17 preparaciones de proteínas, se resolvieron tres nuevas estructuras de proteínas.

En conclusión, un enfoque de cribado sistemático para E. coli Los clones de expresión de proteínas humanas se describen aquí. Con este enfoque, se creó un recurso público de 2746 clones que permite proyectos de genómica funcional para seleccionar clones y expresar proteínas humanas de interés.


Clonación molecular, expresión, purificación y caracterización funcional de dammarenediol sintasa de Panax ginseng

& # 13 El objetivo de este estudio es clonar y caracterizar la expresión del gen dammarenediol sintasa y luego determinar la relación entre la expresión del gen dammarenediol sintasa que está involucrado en la vía biosintética del ginsenósido y el contenido de ginsenósido. Se construyó una biblioteca de fagos de ADNc a partir de una raíz de ginseng de cinco años. La biblioteca de ADNc se examinó en busca del gen de la sintasa de dammarenediol utilizando sus cebadores específicos. Posteriormente se clonó y expresó en el vector pET-30a. El plásmido recombinante pET-30a-DS se expresó en Rosetta E. coli. La proteína DS recombinante se purificó mediante cromatografía de afinidad. La producción de dammarenediol se detectó mediante cromatografía líquida-espectrometría de masas (LC-MS). Los resultados mostraron que el gen de la dammarenediol sintasa se clonó a partir de la biblioteca de ADNc y se expresó en Rosetta. E. coli y el análisis SDS-PAGE mostró la presencia de proteína DS purificada. LS-MS mostró la actividad de la proteína DS, a medida que aumenta el contenido de proteína, aumenta el dammarenediol. Nuestros resultados indican que la proteína recombinante dammarenediol sintasa podría aumentar la producción de dammarenediol y la expresión de DS jugó un papel vital en la biosíntesis de ginsenósidos en P. ginseng.

1. Introducción

Medicinal Panax ginseng C. A. Meyer pertenece a Panax género de la familia Araliaceae. Como planta medicinal tradicional, se ha utilizado durante miles de años. Los estudios de farmacología y química médica moderna han confirmado que varias composiciones de ginseng tienen un papel en la mejora de la inmunidad, protección neural, antienvejecimiento, antidepresivo, antitumoral y otros aspectos [1-6] y también tienen buenas perspectivas de aplicación con un valor económico considerable.

A pesar de estas perspectivas, la dificultad del suministro de ginsenósidos en forma pura en cantidades mayores ha impedido su uso como fármacos clínicos. Y la calidad y el crecimiento de los ginsengs se vieron severamente restringidos por su baja tasa de crecimiento, debido al impacto del clima, la geografía y las condiciones de cultivo [7, 8]. El aislamiento y la purificación de cada ginsenósido implica procedimientos más largos y complicados. Alternativamente, la expresión de los genes para enzimas biosintéticas en organismos hospedadores heterólogos, con suerte en microbios de crecimiento rápido como Escherichia coli, puede conducir a la producción de ginsenósidos en grandes cantidades. Se esperaba que la ingeniería genética se convirtiera en la forma más prometedora de producir metabolitos secundarios medicinales de bajo contenido, y la clonación de los genes relevantes de la biosíntesis de ginsenósidos es muy esperada.

El ginsenósido pertenece al triterpenoide, que podría clasificarse en tipo dammarano y tipo oleanano [9, 10] según la estructura básica de la aglicona, y la mayoría de los ginsenósidos eran de tipo dammarano. En la actualidad, el proceso biosintético se puede dividir en 3 procesos: (1) síntesis de pirofosfato de isopreno 3 y pirofosfato de metil alilo (2) síntesis de importantes precursores intermedios de óxido de 2,3-escualeno y (3) ciclación de 2,3 oxidación del escualeno [10, 11]. La ciclación del oxidoscualeno es una ramificación biosintética que dirige no solo los fitoesteroles y triterpenos, sino también los ginsenósidos de tipo dammarano y oleanano. En un estudio anterior, el primer paso comprometido en la síntesis de ginsenósidos es la ciclación de 2, 3-oxidoscualeno a dammarenediol II, catalizada por el DS del grupo oxidoscualeno ciclasa [12]. Significa que la oxidación del escualeno se sintetizó primero en dammarenediol bajo la acción de la dammarenediol sintasa (DS), y luego se generaron varios tipos de saponinas de dammarano a través de una serie de reacciones de hidroxilación y glicosilación [10].

En los últimos años, muchas investigaciones se centran en el desarrollo de sistemas biológicos eficaces para la producción de ginsenósidos mediante el uso de tecnología recombinante. Recientemente, se ha clonado y caracterizado funcionalmente un gran número de triterpeno sintasas pentacíclicas de varias especies de plantas [13-15]. Sin embargo, la expresión de los genes de las enzimas biosintéticas en organismos hospedadores heterólogos, como Escherichia coli, no se ha obtenido. Y si hubo una cierta correlación entre la actividad de DS y el contenido de saponina in vitro todavía necesitaba una verificación experimental. En nuestro presente estudio, intentamos clonar y expresar la dammarenediol sintasa en el sistema procariótico, la primera enzima comprometida para la biosíntesis de sapogenina genuina de ginsenósidos de tipo dammarano. Se demostró que la proteína sintasa de dammarenediol endógena se obtuvo por expresión procariota y se analizó la correlación de la actividad de DS y la acumulación de dammarenediol por LC-MS.

2. Materiales y métodos

2.1. Material experimental

Se extrajo ginseng de uno, tres, cuatro y cinco años del Jardín Botánico Medicinal de la Universidad Agrícola de Jilin, y las raíces fibrosas de los tejidos de la raíz del ginseng se utilizaron en estudios experimentales.

2.2. Reactivos

El reactivo Trizol se compró a Invitrogen, el kit de construcción de biblioteca de ADNc Smart TM se compró a la empresa Clontech, EE. UU., Gigapack El kit de extracto de empaque de oro se adquirió en la empresa Stratagene, la transcriptasa inversa, la ADN polimerasa Ex Taq, el vector pMD18-T, el marcador DL-2000 se adquirieron en la empresa TaKaRa, el Real Master Mix se adquirió en la empresa Changchun, el kit de purificación de proteína Ni-agarosa se compró a Beijing Kangwei Century Company, el escualeno se compró a Changchun DingGuo Biotechnology Co., Ltd., el estándar Dammarenediol se compró a YunNan XiLi Biotechnology Co., Ltd., la enzima escualeno epoxidasa se preparó en el laboratorio, y E. coli La cepa Rosetta y el vector de expresión pET-30a eran de nuestro laboratorio.

2.3. Biblioteca de fagos de ADNc de construcción y detección de tejido de raíz de ginseng

Se extrajo el ARN total de los tejidos de la raíz de ginseng de diferentes años utilizando Trizol. El ADNc se sintetizó utilizando el ARN total como molde, con transcriptasa inversa AMV y cebadores oligo-dT. biblioteca de ADNc de longitud completa de un niño de cinco años P. ginseng se construyó utilizando el kit de construcción de bibliotecas de ADNc SmartTM. La selección de la placa, la detección del tamaño del fragmento insertado y el cálculo de la tasa de reorganización se realizó mediante PCR (Sentido: CCATTGTGTTGGTACC CGG, Antisentido: ATACGACTCACTATAG GGCGAATT).

2.4. Clonación de genes DS y análisis de secuencia

Los cebadores conservadores del gen DS (Sentido: ATTAAGAATGTGGAAGCAGAAGG, Antisentido: CTTAAATTTTGAGCTGCTGGTG) se diseñaron basándose en las secuencias relacionadas de GenBank y se utilizaron para cribar el gen DS de la biblioteca de ADNc. El fragmento de PCR dirigido se recuperó después de la electroforesis en gel de agarosa y se clonó en el vector pMD18-T. Para identificar el plásmido recombinante correcto, se secuenció (ingeniería biológica de Shanghai Sheng Gong, Shanghai) y las secuencias de ADN del gen DS se enviaron a GenBank (número de acceso: JN596111). El nombre de la construcción correcta es pMD-18T-DS.

2.5. Construcción e identificación de pET-30a-DS

Los fragmentos del gen pET-30a y DS del plásmido pMD-18T-DS fueron digeridos por Suboficialyo y NoI, y ligado con T4DNA ligasa a 16 ° C, luego transformado en Rosetta E. coli célula competente y se cultivó durante la noche a 37 ° C.Los clones positivos se seleccionaron mediante doble digestión y, para identificar el inserto correcto, se envió para secuenciación. El clon positivo se denominó pET-30a-DS.

2.6. Expresión inducida de proteína recombinante y purificación de fusión

E. coli Las células que albergan una construcción de expresión se cultivaron en 10 ml de caldo LB que contenía 30 μg / ml de kanamicina más 34 μg / mL de cloranfenicol para Rosetta a 37 ° C durante la noche con agitación constante. Las bacterias recombinantes se inocularon en medio LB y se cultivaron a 37 ° C hasta una DO600 de 0,4 a 0,6, con diferentes concentraciones de IPTG (concentraciones finales de 0,1, 0,2, 0,6, 0,8 y 1,0 mmol / L) para inducir la expresión, y se indujeron durante 4 h bajo la concentración óptima determinada de IPTG. El lisado bacteriano se recogió 4 h más tarde y se detectó mediante electroforesis SDS-PAGE, con la Rosetta recombinante no inducida como control.

Los cultivos nocturnos de células bacterianas se diluyeron 50 veces en 1 L de caldo LB, se complementaron con los antibióticos apropiados, se cultivaron como se indicó anteriormente hasta que se alcanzó una DO600 de 0,4 a 0,6 y luego se indujeron a expresar las proteínas recombinantes durante 4 h mediante la adición de isopropilo. β-D-galactopiranósido (IPTG) hasta una concentración final de 0,6 mM. Las células se sometieron a ultrasonidos durante 2 min y el precipitado se disolvió con una solución de tampón de unión soluble (20 mmol / L de Tris-HCl, 10 mmol / L, imidazol, 0,5 mol / L de NaCl). El precipitado obtenido de 12000 g de centrifugación durante 20 min es el cuerpo de inclusión. El cuerpo de inclusión se disolvió en un baño de agua helada durante 1 hy se centrifugó a 10000 g durante 20 min, y el sobrenadante se filtró por 0,45 μm filtración por membrana. Después de la cromatografía de afinidad de Ni-agarosa equilibrada, las proteínas recombinantes etiquetadas con His se solubilizaron mediante disolvente de tampón de unión soluble y se purificaron mediante cromatografía de agarosa de Ni-NTA y finalmente se recogieron los picos de elución de acuerdo con un valor de absorción ultravioleta de 280 nm.

2.7. Detección de la actividad de la proteína recombinante

En el presente estudio, la enzima SEQ se expresó y purificó utilizando un vector de expresión procariótico, que se había completado previamente. El proceso de reacción catalítica de la enzima DS consta de dos etapas. En primer lugar, se seleccionó el escualeno como sustrato. Bajo la misma cantidad de sustrato, se catalizó escualeno con la misma cantidad de enzima SQE para producir el producto intermedio de 2,3-oxidoscualeno en diferentes sistemas de reacción. Posteriormente, el 2,3-oxidoscualeno se catalizó adicionalmente con diferentes cantidades de enzima DS para producir dammarandiol. Una vez completada la reacción enzimática, la enzima se inactivó calentando a 100 ° C. Con base en las características de alta solubilidad de la sapogenina dammarandiol en etanol y baja solubilidad en acetona, luego de la extracción con etanol, se agregó acetona al etanol para separar el dammarandiol, que luego se detectó mediante la técnica LC-MS.

El experimento podría dividirse en cinco sistemas de reacción enzimática DS. Se añadió el sustrato de escualeno (20 L) a un tubo centrífugo que tenía tampón Tris-HCl (pH 6,0) y luego se añadió la solución de enzima DS (0,65 g / ml) 5 μL, 10 μL, 15 μL, 20 μL, 25 μL respectivamente, y solución de enzima SQE agregada (0.35 g / mL) 20 μL en cada uno de los tubos de centrífuga y reaccionaron a 37 ° C durante 1 h, y luego se elevó la temperatura a 100 ° C. Después de 10 min, se detuvo la reacción enzimática. La producción de dammarnediol se detectó mediante cromatografía líquida-espectrometría de masas en tándem.

Estado de la columna cromatográfica: columna Zorbax Extend-C18, 5 μm tamaño de partícula,

mmL · D, American Agilent company fase móvil: agua, acetonitrilo, ácido fórmico flujo: 0,8 ml / min temperatura de la columna: temperatura ambiente tamaño de la muestra: 25 μCondiciones de espectrometría de masas: fuente de ionización por electropulverización (ESI) voltaje de inyección de iones: 5500 V temperatura: 550 ° C fuente de gas 1 (GS1, N2) presión: 70 psi gas 2 (GS2, N2) presión: 60 psi monitoreo en modo de iones positivos : modo de exploración para la monitorización de iones positivos tensión DP: 70 V tensión EP: 10 V CXP: 4,0 V energía de desintegración: 40 V. El par de iones para el análisis cualitativo es 391 / 93,1 el par de iones para el análisis cuantitativo es 391/149. Los productos de diferentes sistemas de reacción enzimática se inyectan en el orificio de inyección para observar los cambios en el área del pico de elución. La concentración estándar de dammarenediol fue de 1 mg / L y la cantidad de generación de dammarenediol se calculó comparándola con la relación de área de pico del estándar.

3. Resultados y análisis

3.1. Síntesis de ADNc de doble hebra y detección de calidad de la biblioteca de fagos

Después de detectar la espectrofotometría ultravioleta, el A260 / A280 del ARN total es 1,96. Los resultados de la electroforesis mostraron que el cDNA bicatenario se localiza entre 0,3 y 2,5 kb, presentando una banda alargada en forma de cascada, que concuerda bien con la distribución del DNA del tejido vegetal. De acuerdo con el número de colonia bacteriana y los resultados de identificación por PCR líquida de bacterias, la tasa de recombinación fue del 95,17%. La capacidad de la biblioteca original es

3.2. Clonación de genes DS y análisis de secuencia

Después de la electroforesis, el producto de amplificación por PCR del gen DS obtuvo una banda específica de aproximadamente 2310 pb, que coincidió bien con los resultados esperados. El plásmido pMD-18T-DS fue digerido por Xbayo y PstI y un tamaño de inserto de 2310 pb, se obtuvo el tamaño que corresponde a la correa objetivo. El análisis BLAST encontró que el ADNc de DS portaba un fragmento de marco de lectura abierto completo (ORF) de 2310 pb. Se encontró que los aminoácidos de DS (769 aminoácidos con una masa molecular prevista de 84,6 kDa) eran 56, 50 y 48% idénticos a los de β-amirina sintasa, cicloartenol sintasa y lanosterol sintasa en P. ginseng.

3.3. Identificación del vector de expresión recombinante y expresión inducida de recombinante

Se obtuvo una banda específica con un tamaño de aproximadamente 2310 pb, consistente con lo esperado, mediante la aplicación de Suboficialyo y NoDoblo la digestión pET-30a-DS. Los resultados encontraron que el gen DS se insertó en el vector pET-30a y se construyó el plásmido recombinante pET-30a-DS.

El plásmido recombinante pET-30a-DS se transformó en Rosetta E. coli para ser inducido para la expresión génica. El producto expresado se identificó mediante SDS-PAGE y se encontraron bandas de proteína específicas de aproximadamente 89 kDa, que coincidían con el tamaño de peso molecular de la proteína recombinante etiquetada con His predicha (Figura 1). Cuando la concentración final de IPTG alcanzó 0,6 mmol / L, la expresión de proteínas es más alta y la diferencia de expresión de proteínas no fue significativa en diferentes intervalos de tiempo (1, 2, 3, 4, 5, 6 y 7 h). La purificación de proteínas recombinantes mediante análisis SDS-PAGE mostró que había bandas de proteínas a aproximadamente 89 kDa, que tenían el mismo peso molecular con la proteína de fusión pET-30a-DS, y una gran pureza (Figura 2).


Análisis SDS-PAGE de la expresión de DS en E. coli. Carril M: marcador de peso molecular Carril 1: extractos de células crudas de E. coli Rosetta que contiene pET-30a Carril 2: extractos de células crudas después de 4 h después de la inducción sin IPTG de E. coli Rosetta que contiene pET-30a-His-DS Carril 3-9: extractos de células crudas después de 4 h después de la inducción con IPTG de E. coli Rosetta que contiene pET-30a-His-DS. Los pesos moleculares de los nuevos componentes proteicos concuerdan bien con los previstos para las proteínas de fusión.


Resultado de la purificación de la proteína recombinante. Carril Ms: marcador de peso molecular de proteína Carril1: extractos de células crudas de E. coli Rosetta que contiene pET-30a Carril 2: extractos de células crudas después de 4 h después de la inducción sin IPTG de E. coli Rosetta que contiene pET-30a-His-DS Lane3: extractos de células crudas después de 4 h después de la inducción con IPTG de E. coli Rosetta que contiene pET-30a-His-DS. Carril 4: la proteína recombinante purificada de DS. La masa molecular purificada fusionada con la proteína etiqueta de His concuerda bien con las predichas para las proteínas de fusión.
3.4. Detección de actividad biológica de proteínas recombinantes

Dammarenediol se identificó mediante la cromatografía de iones de extracción de LC-MS y el tiempo de retención de los picos fue de 12,0 min. La detección por LC-MS mostró que bajo la condición de cantidades similares del sustrato escualeno, con el aumento en la cantidad de enzima DS, en comparación con el área del pico estándar de dammarandiol, la cantidad de generación de damarindiol aumentó gradualmente. Los resultados experimentales indicaron que las proteínas recombinantes expresadas en E. coli tenía la actividad y podía generar escualeno en dammarenediol. Al mismo tiempo, se encontró una estrecha correlación de dammarenediol sintetasa y la cantidad de generación de ginsenósido (Figura 3 y Tabla 1).


(a)
(B)
(C)
(D)
(mi)
(F)
(a)
(B)
(C)
(D)
(mi)
(F) Diagrama de flujo de extracción de iones del espectrómetro de masas LC-MS (indica el pico). La coordenada horizontal y la coordenada vertical indican el momento de aparición del pico y la altura del pico. (a) el tiempo de aparición del pico de la muestra estándar de dammarendiol (b) - (f) el tiempo de aparición del pico de dammarendiol en los sistemas de reacción con diferentes cantidades de enzima DS (las cantidades de enzima DS son 5, 10, 15, 20 y 25 μL, resp.).

4. Discusión

La biblioteca de cDNA construida por la tecnología SMART aseguró la integridad de la información de la biblioteca de cDNA [16, 17]. Además, rara vez se informó sobre este tipo de construcción de biblioteca de ADNc de la raíz de ginseng de cinco años. La tecnología SMART puede mejorar la probabilidad de expresión y la eficiencia de recombinación del gen de la región de inserción, de modo que los genes de baja abundancia en la biblioteca se enriquecieron, lo que coincidía con la baja abundancia de la expresión génica en la separación de la raíz de ginseng. La capacidad de almacenamiento original de la biblioteca de ADNc de raíz de ginseng de cinco años construida en este estudio es superior a 10 6 ufp / mL -1, los fragmentos insertados se concentraron principalmente entre 500 y 2500 pb, que ha alcanzado el valor estándar de biblioteca y ha sentado las bases para el cribado de genes clave en la vía biosintética de ginsenósidos.

El primer paso comprometido en la síntesis de ginsenósidos es la ciclación del 2,3-oxidoscualeno a dammarenediol, catalizada por el DS del grupo oxidoscualeno ciclasa (OSC). Dammarenediol sintasa es la enzima más importante en la ruta biosintética, que tuvo una gran relevancia para el contenido de ginsenósidos. Además, el contenido fue extremadamente bajo en raíz de ginseng [18]. En este estudio se eligió ginseng saúco procedente de una exuberante temporada de crecimiento y metabolismo, con una expresión relativamente alta de todos los tipos de genes. Y el gen DS del marco de lectura abierto que codifica 769 aminoácidos se logró mediante la biblioteca de ADNc construida, por lo que se proporcionó una referencia para una mayor comprensión de las características y funciones del gen DS. La clonación del cDNA de dammarenediol sintasa en este estudio ha proporcionado un paso significativo para la producción de ginsenósidos de tipo dammarane mediante sistemas de expresión heterólogos, ya que la (s) hidroxilación (es) y glicosilación (es) posteriores conducen a una variedad de estructuras de ginsenósido.

La investigación de años recientes sobre la obtención de la proteína enzimática clave activa mediante el vector de expresión procariota rara vez se ha informado. Morita y col. [15] han observado la producción de dammarenediol II por la expresión de PNA en un mutante de levadura deficiente en ERG7 (GIL77), pero su mecanismo regulador no está claro. Insertamos el ORF del cDNA de DS en el vector de expresión pET-30a, y la dammarenediol sintasa se expresó y purificó con alta pureza que se muestra en SDS-PAGE. Debido a que la secuencia del gen DS contenía una gran cantidad de codones raros, la expresión en E. coli Origami B (DE3) fue menor y se utilizaron una serie de bacterias de expresión de Rosetta para ayudar a mejorar la cantidad de expresión. La razón fue que el plásmido PRARE2 se transportaba en la bacteria Rosetta, que podía complementar el ARNt correspondiente a los siete codones raros ausentes de E. coli, y en comparación con la bacteria Origami B (DE3), era más adecuada para la expresión de proteínas que contienen un codón raro [19, 20].

Con base en la investigación anterior, la cantidad de generación de dammarenediol en diferentes cantidades de reacción enzimática de DS se analizó mediante tecnología LC-MS. El método LC / MS tuvo una alta especificidad, sensibilidad, precisión y otras ventajas, con un rango de detección de 2,0 ng · mL −1 [21, 22]. El análisis LC-MS reveló que bajo una cantidad similar del sustrato escualeno, con una disminución correspondiente en la cantidad de enzima DS, la cantidad de generación de dammarenediol aumentó progresivamente, lo que ilustró que la proteína recombinante expresada en E. coli tenía actividad. Los experimentos demostraron además evidencia de la estrecha correlación de la sintetasa de dammarenediol y la producción de saponina. in vitro, pero la actividad catalítica específica aún no estaba clara. Han y col. [23] estudiaron el gen del ginseng del DS mediante la interferencia del ARN y encontraron que la interferencia del ARN del DS conducía a una reducción de la producción de ginsenósido al 84,5% en P. ginseng raíces, que fue muy similar a los hallazgos de este estudio. Estos resultados indicaron que la sobreexpresión de DS será útil para mejorar la producción de ginsenósidos farmacológicamente importantes a partir de P. ginseng u otras especies vegetales por transformación genética.

En conclusión, este estudio explicó además que el gen DS juega un papel clave en la vía de biosíntesis de ginsenósidos, la acumulación de ginsenósidos era inseparable de los cambios en los niveles de expresión de genes clave, hasta cierto punto podría determinar la tendencia de la biosíntesis de saponinas triterpénicas, y DS fue uno de los las enzimas clave en el control de la síntesis de ginsenósidos. Por lo tanto, lo más probable es que mejorar la expresión del gen DS del ginseng mediante la tecnología de ingeniería genética fuera un medio eficaz para aumentar la cantidad de ginsenósidos. Por lo tanto, nuestro estudio proporciona datos experimentales básicos disponibles para el estudio de los genes del DS y también proporciona una referencia teórica para el estudio posterior en profundidad de la función del gen del DS y el mecanismo regulador de la vía biosintética del ginsenósido.

Conflicto de intereses

Los autores declaran no tener ningún conflicto de intereses.

Expresiones de gratitud

Este trabajo fue apoyado por la Fundación Nacional de Ciencias Naturales de China (30570185 y 31070316).

Referencias

  1. D. F. Qu, H. J. Yu, Z. Liu et al., "El ginsenósido Rg1 mejora la respuesta inmune inducida por el antígeno recombinante de Toxoplasma gondii SAG1", Parasitología veterinaria, vol. 179, no. 1 & # x20133, págs. 28–34, 2011. Ver en: Sitio del editor | Google Académico
  2. R. Zhao, Z. Zhang, Y. Song, D. Wang, J. Qi y S. Wen, “Implicación de la fosfatidilinositol-3 quinasa / Akt / glucógeno sintasa quinasa-3& # x3b2 vía en la atenuación del ginsenósido Rb1 de la neurotoxicidad inducida por beta-amiloide y la fosforilación de tau ", Revista de etnofarmacología, vol. 133, no. 3, págs. 1109–1116, 2011. Ver en: Sitio del editor | Google Académico
  3. Y. C. Kim, S. R. Kim, G. J. Markelonis y T. H. Oh, "Los ginsenósidos Rb1 y Rg3 protegen las células corticales de rata cultivadas de la neurodegeneración inducida por glutamato", Revista de investigación en neurociencia, vol. 53, no. 4, págs. 426–432, 1998. Ver en: Sitio del editor | Google Académico
  4. H. Dang, Y. Chen, X. Liu et al., "Efectos antidepresivos de las saponinas totales de ginseng en la prueba de natación forzada y modelos de depresión de estrés leve crónico", Avances en neuropsicofarmacología y psiquiatría biológica, vol. 33, no. 8, págs. 1417–1424, 2009. Ver en: Sitio del editor | Google Académico
  5. J. Liu, K. Shimizu, H. Yu, C. Zhang, F. Jin y R. Kondo, "Estereoespecificidad del grupo hidroxilo en C-20 en la acción antiproliferativa del ginsenósido Rh2 en las células del cáncer de próstata", Fitoterapia, vol. 81, no. 7, págs. 902–905, 2010. Ver en: Sitio del editor | Google Académico
  6. Z. Chen y Z. Gang, "Avances en la investigación de los efectos farmacológicos de ginsenoside Rd", Revista China de Nuevas Drogas, vol. 20, no. 11, págs. 953–958, 2011. Ver en: Google Scholar
  7. H. Chun Xi, Z. Shou Jing, L. Yan Long y W. Jian Hua, “Avances en la transformación genética de Panax ginseng,” China Biotecnología, vol. 29, no. 9, págs. 91–96, 2009. Ver en: Google Scholar
  8. Y. Liang, S. Zhao y X. Zhang, “La supresión antisentido de la cicloartenol sintasa da como resultado niveles elevados de ginsenósido en Panax ginseng raíces peludas " Reportero de Biología Molecular Vegetal, vol. 27, no. 3, págs. 298–304, 2009. Ver en: Sitio del editor | Google Académico
  9. M. H. Lee, J. H. Jeong, J. W. Seo et al., “Biosíntesis mejorada de triterpenos y fitosteroles en Panax ginseng sobreexpresa el gen de la escualeno sintasa ” Fisiología vegetal y celular, vol. 45, no. 8, págs. 976–984, 2004. Ver en: Google Scholar
  10. Y. S. Kim, J. Y. Han, S. Lim e Y. E. Choi, "Ingeniería metabólica del ginseng: regulación de genes relacionados con la biosíntesis de ginsenósidos", Revista de investigación de plantas medicinales, vol. 3, no. 13, págs. 1270–1276, 2009. Ver en: Google Scholar
  11. J. M. Augustin, V. Kuzina, S. B. Andersen y S. Bak, "Actividades moleculares, biosíntesis y evolución de las saponinas triterpenoides", Fitoquímica, vol. 72, no. 6, págs. 435–457, 2011. Ver en: Sitio del editor | Google Académico
  12. T. Kushiro, Y. Ohno, M. Shibuya e Y. Ebizuka, “Conversión in vitro de 2,3-oxidoscualeno en dammarenediol por Panax ginseng microsomas " Boletín Biológico y Farmacéutico, vol. 20, no. 3, págs. 292–294, 1997. Ver en: Google Scholar
  13. I. Iturbe-Ormaetxe, K. Haralampidis, K. Papadopoulou y A. E. Osbourn, "Clonación molecular y caracterización de triterpeno sintasas de Medicago truncatula y Lotus japonicus", Biología Molecular Vegetal, vol. 51, no. 5, págs. 731–743, 2003. Ver en: Sitio del editor | Google Académico
  14. H. Hayashi, P. Huang, A. Kirakosyan et al., “Clonación y caracterización de un ADNc que codifica & # x3b2-amirina sintasa involucrada en las biosíntesis de glicirricina y sojaponina en el regaliz ”. Boletín Biológico y Farmacéutico, vol. 24, no. 8, págs. 912–916, 2001. Ver en: Sitio del editor | Google Académico
  15. M. Morita, M. Shibuya, T. Kushiro, K. Masuda e Y. Ebizuka, “Clonación molecular y expresión funcional de triterpeno sintasas de guisantes (Pisum sativum): nuevo & # x3b1-enzima productora de amirina es una triterpeno sintasa multifuncional ", Revista europea de bioquímica, vol. 267, no. 12, págs. 3453–3460, 2000. Ver en: Sitio del editor | Google Académico
  16. R. Wellenreuther, I. Schupp, A. Poustka y S. Wiemann, "Amplificación SMART combinada con fraccionamiento de tamaño de ADNc para obtener clones grandes de longitud completa", BMC Genomics, vol. 5, no. 1, pág. 36, 2004.Ver en: Sitio del editor | Google Académico
  17. G. K. Fu y L. L. Stuve, "Método mejorado para la construcción de bibliotecas de ADNc enriquecidas de longitud completa", BioTécnicas, vol. 34, no. 5, págs. 954–957, 2003. Ver en: Google Scholar
  18. P. Tansakul, M. Shibuya, T. Kushiro e Y. Ebizuka, “Dammarenediol-II sintasa, la primera enzima dedicada para la biosíntesis de ginsenósidos, en Panax ginseng,” Letras FEBS, vol. 580, no. 22, págs. 5143–5149, 2006. Ver en: Sitio del editor | Google Académico
  19. H. Dan, A. Balachandran y M. Lin, "Un par de vectores de expresión de escherichia coli independientes de la ligación para la rápida adición de una etiqueta de afinidad de polihistidina a los extremos N o C de proteínas recombinantes". Revista de técnicas biomoleculares, vol. 20, no. 5, págs. 241–248, 2009. Ver en: Google Scholar
  20. T. Ke, S. Liang, J. Huang et al., "Un nuevo método basado en PCR para la expresión procariota de alto rendimiento de genes de péptidos antimicrobianos", Biotecnología BMC, vol. 12, artículo 10, 2012. Ver en: Google Scholar
  21. M. Vogeser y F. Kirchhoff, "Progreso en la automatización de LC-MS en medicina de laboratorio", Bioquímica clínica, vol. 44, no. 1, págs. 4–13, 2011. Ver en: Sitio del editor | Google Académico
  22. A. Preis, L. Mugisha, B. Hauser, A. Weltring y T. Deschner, “Andrógenos y niveles de metabolitos de andrógenos en suero y orina de chimpancés de África oriental (Pan troglodytes schweinfurthii): comparación de análisis de EIA y LC-MS, " Endocrinología general y comparada, vol. 174, no. 3, págs. 335–343, 2011. Ver en: Sitio del editor | Google Académico
  23. J. Y. Han, Y. S. Kwon, D. C. Yang, Y. R. Jung y Y. E. Choi, “Silenciamiento inducido por la expresión y la interferencia del ARN del gen de la sintasa de dammarenediol en Panax ginseng,” Fisiología vegetal y celular, vol. 47, no. 12, págs. 1653–1662, 2006. Ver en: Sitio del editor | Google Académico

Derechos de autor

Copyright & # xa9 2013 Wei Hu et al. Este es un artículo de acceso abierto distribuido bajo la licencia de atribución de Creative Commons, que permite el uso, distribución y reproducción sin restricciones en cualquier medio, siempre que el trabajo original se cite correctamente.


Afiliaciones

J Craig Venter Institute (JCVI), 9704 Medical Center Drive, Rockville, MD, 20850, EE. UU.

Seesandra V Rajagopala, Hsi-Kuang Huang, Jorge David Mendez-Rios, Jonathan Franca-Koh, Meher Preethi Boorgula y Peter Uetz

Escuela de Graduados en Ciencias Biológicas, Instituto de Ciencia y Tecnología de Nara, Ikoma, Nara, Japón

Natsuko Yamamoto, Tomoko Nakamichi y Hirotada Mori

Departamento de Bioquímica y Biofísica, Universidad Texas A & amp M, College Station, TX, 77843-2128, EE. UU.

Adrienne E Zweifel y amp James C Hu

Instituto Nacional de Tecnología y Evaluación, Kazusakamatari, Kisarazu, Chiba, 292-0818, Japón

Kazutoshi Fujita y Ken-ichirou Suzuki

Departamento de Ciencias Biológicas, Universidad Purdue, West Lafayette, IN, 47907, EE. UU.

Instituto de Biociencias Avanzadas, Universidad de Keio, ciudad de Tsuruoka, Yamagata, Japón

Proteros Biostructures, Martinsried, Alemania

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

Autores correspondientes


ADN recombinante (ADNr)

ADN RECOMBINANTE (ADNr)

Puede definirse como "Cambiar los genes de un organismo mediante el uso de procesos in vitro".

El primer ADN recombinante fue construido por Stanley Cohen y Harbert Boyer (1973). Cortaron el fragmento de ADN de un plásmido que portaba un gen de resistencia a los antibióticos en la bacteria Salmonella typhimyreum y lo vincularon al plásmido de Escherichia coli. Este ADNr se introdujo en E. coli y se hizo multiplicar (clonación de genes) haciendo varias réplicas.


Resultados y discusión

Tamaño de las células bacterianas distribuidas ampliamente en una población clonal.

Empleamos un derivado integrado de GFP de E. coli DH1, llamado BSKY, como población clonal ancestral. La DH1, incluida la BSKY, es grande, filamentosa y con forma de varilla y tiene un tamaño más heterogéneo que la cepa de tipo salvaje, MG1655 (Figura 1). Esta propiedad implica que BSKY tiene la capacidad de evolucionar a tamaños más pequeños al reducir la fracción filamentosa en respuesta a las selecciones apropiadas sin enfrentar limitaciones físicas. Por lo tanto, consideramos esta cepa como un antepasado apropiado para probar si la evolución a un tamaño más pequeño va acompañada de cambios en el crecimiento. Utilizamos un clasificador de células activadas por fluorescencia (FACS) para clasificar las células bacterianas de acuerdo con su tamaño relativo, en función del valor de dispersión directa (FSC) en la citometría de flujo (recuadro de la Figura 1B). El FSC refleja básicamente la longitud, o el diámetro más largo, de las bacterias en forma de bastón y concuerda bien con la observación microscópica [18]. Como resultado, las distribuciones de tamaño más grandes y / o más amplias también se capturaron de manera consistente en citometría de flujo y microscopía. Empleamos valores medios y desviaciones estándar en una escala logarítmica para caracterizar estas distribuciones de tamaño.

Distribuciones de tamaño de celda de dos E. coli son. (A) Imágenes de contraste de fase de dos E. coli cepas (izquierda, MG1655 y derecha, BSKY). La barra de escala representa 10 μm. (B) Distribuciones de tamaño celular obtenidas por microscopía. Las líneas continuas y discontinuas indican BSKY y MDS42, respectivamente. El recuadro representa las distribuciones de tamaño celular correspondientes obtenidas por citometría de flujo.

Se examinaron ciclos repetidos de selección de tamaño con propagación de población.

A partir de una población celular genéticamente idéntica de BSKY, probamos la posibilidad de evolución hacia un tamaño de celda más pequeño a través de selecciones de tamaño, donde la fuerza de la selección se examinó de 2 formas (Figura 2A y B). Nuestras rondas experimentales consisten en dos selecciones simples, selección de tamaño a través de FACS y selección de crecimiento en un cultivo. Las células cuyo tamaño cumplió con los criterios de selección representaron una mayor aptitud en la selección de tamaño, y las células de crecimiento más rápido naturalmente superaron a las de crecimiento lento en los cultivos. Se tomaron muestras de las células del cultivo de la noche a la mañana, y las fracciones particulares que exhibían los tamaños diana se clasificaron en medio fresco usando FACS. Las selecciones de tamaño se examinaron en el 1% más pequeño de las células (selección severa) y alrededor del pico (selección suave) para producir los linajes Svr y Mld, respectivamente. El número de células clasificadas se decidió en función de la tasa de crecimiento de la ronda anterior, por lo que alcanzaron aproximadamente 107 células / ml después del cultivo durante la noche. Los valores típicos fueron de 20 a 2000 células en 1 ml de medio fresco. De acuerdo con los tamaños de población pequeños, las concentraciones de células fluctuaron día a día, incluso en las células de transferencia en serie general (linaje T) (Figura 3A). Estas rondas se repitieron diariamente, en paralelo con el linaje T, que no se clasificó por tamaño usando FACS y se usó como control (Figura 2C). Los procedimientos más detallados se describen en la sección de Métodos.

Esquemas de las estrategias de evolución experimental. Las rondas de evolución de tamaño dirigida consisten en selecciones de tamaño usando un clasificador de células y selecciones de crecimiento subsiguientes en cultivo celular. Las selecciones de tamaño se definieron como el 1% más pequeño de la población (linaje Svr, (A)) y alrededor del pico (linaje Mld, (B)). Como control, el linaje T consiste en la selección del crecimiento sin selección del tamaño. (C). El procedimiento detallado se describe en el texto principal.

Proceso de evolución y poblaciones finales de linajes evolucionados. La trayectoria de la concentración celular. (A), el tamaño medio de la celda (B) y la desviación estándar (C) bajo el proceso de selección de tamaño. El diamante abierto, el círculo abierto y el círculo cerrado representan los linajes Svr-, Mld- y T, respectivamente. (D) Distribuciones de tamaño celular de la población de la ronda final (izquierda) y los 12 clones aislados (derecha), donde los aislados se distinguen por líneas en escala de grises. Los dos paneles superiores representan clones ancestrales. Los otros paneles corresponden a los linajes T-, Svr- y Mld- en la parte inferior. Los recuadros representan los ID de las células en la Tabla 1. Todos los datos se obtuvieron a aproximadamente 107 células / ml. La línea de puntos indica uno de los clones aislados de CA (arriba a la izquierda). (MI) Se muestran imágenes de contraste de fase de los clones aislados. Los recuadros también representan los ID de celda en la Tabla 1. Las barras blancas indican 10 μm. (F) El tamaño celular medio de los 12 aislamientos. (GRAMO) La desviación estándar en el tamaño de la celda de los 12 aislamientos. Las barras de error son límites de confianza del 95%. PAG-los valores son para la prueba t (N = 12).

Disminuyó el tamaño de las células bacterianas y aumentó la homogeneidad

Durante los ciclos de selección, observamos cambios en las distribuciones de tamaño (Figura 3B y C). En el linaje Svr, el tamaño celular medio disminuyó después de 15 días (190 generaciones), logrando una reducción de 2,2 veces en comparación con el linaje T en el último día (288 generaciones) (Figura 3B). Por el contrario, el tamaño medio de las células en el linaje Mld mostró sólo una ligera reducción. Estos resultados son consistentes con la fuerza de la selección de tamaño. También encontramos que la variación en el linaje Mld comenzó a disminuir después de 4 días (57 generaciones), en relación con los linajes Svr y T (Figura 3C).

Después de 22 días (o 22 rondas), obtuvimos poblaciones de células de cada linaje (T22P, Svr22P y Mld22P). Además, aislamos 12 poblaciones clonales de cada linaje (T22C, Svr22C y Mld22C, Tabla 1). Luego comparamos las distribuciones de estas poblaciones con la de la población ancestral (AP) y sus clones (AC) (Figura 3D). Las distribuciones de estos aislados se obtuvieron directamente de los cultivos finales durante la noche, sin otra selección de tamaño mediada por FACS (consulte la sección de Métodos). T22P exhibió una distribución de tamaño similar a los AC y los aislados. Los T22C también mantuvieron sus distribuciones de tamaño. Este hallazgo indica que la distribución de tamaño, en ausencia de selecciones de tamaño, permaneció constante en presencia de selecciones de crecimiento a través de cientos de generaciones. En contraste, encontramos que todos los clones en los linajes Svr- y Mld (Svr22Cs y Mld22Cs) evolucionaron en tamaño, según lo diseñado por las selecciones de tamaño (Figura 3D-G), al igual que las distribuciones de Svr22P y Mld22P. Es decir, las distribuciones de Svr22C revelaron tamaños de celda medios muy reducidos y las de Mld22C se redujeron ligeramente (Figura 3F). Ambos linajes redujeron evolutivamente la subpoblación filamentosa. Estos resultados también infieren que el tamaño de las células puede mostrar una heredabilidad similar a la materna, ya que las células pequeñas deberían tender a producir una progenie pequeña, que es similar a las células con el polo viejo que crece más lentamente [19].

También encontramos que la variación en los linajes Svr y Mld disminuyó, pero en diferentes grados (Figura 3G). La variación en Mld22Cs disminuyó en gran medida, mientras que en Svr22Cs disminuyó ligeramente. La selección alrededor del pico puede haber estabilizado la distribución de tamaño, reduciendo la variación de tamaño. Estas propiedades evolucionadas fueron confirmadas por observación microscópica directa (Figura 3E, Archivo adicional 1: Figura S1 y Archivo adicional 2: Figura S2). Estos resultados indican que el tamaño de la célula bacteriana podría evolucionar a través del proceso de selección simple, no solo en promedio, sino también curiosamente en la variación de célula a célula, incluso en la población clonal.

Las células evolucionadas mantuvieron un tamaño pequeño, independientemente de las concentraciones celulares.

Debido a que las selecciones de tamaño se diseñaron para trabajar en el tamaño de la célula a concentraciones celulares particulares y fracciones particulares de las distribuciones, no pueden revelar si los rasgos evolucionados ocurrieron en concentraciones celulares diferentes o fuera de la media (Figuras 2 y 4). De hecho, el tamaño de las células puede cambiar con el tiempo, la concentración celular y / o las fases de crecimiento. El tamaño de las células bacterianas comienza a disminuir después de la fase logarítmica tardía de crecimiento [20]. Por lo tanto, exploramos la distribución de tamaño de 12 clones a diferentes concentraciones de células junto con las curvas de crecimiento. Para cada distribución, en cada punto de tiempo, analizamos mediante monitoreo multipunto la media, el 1% superior y el 1% inferior de las líneas (Figura 4A), donde estas líneas de referencia se establecieron como umbral en las selecciones de tamaño. Estas tres referencias se representaron gráficamente sobre diversas concentraciones de células (Figura 4B y D). Para todos los clones, como se esperaba, incluidas las líneas superior e inferior, el tamaño celular medio de los ancestros comenzó a disminuir a medida que aumentaban las concentraciones celulares, mucho antes de que los cultivos dejaran la fase de crecimiento exponencial (extremo izquierdo en la Figura 4C). Los T22C mostraron una dependencia similar de la concentración celular a los clones ancestrales en cada punto (segundo desde la izquierda en la Figura 4C).

La concentración celular depende del tamaño celular. (A) Las líneas de referencia de la distribución del tamaño de celda. Los símbolos gris oscuro, gris claro y abierto indican el 1% inferior, la media y el 1% superior de las distribuciones de tamaño, respectivamente. (B) Estas imágenes representativas trazan tres referencias (inferior, media y superior) sobre las concentraciones de células. Los dos paneles de la izquierda representan las distribuciones de tamaño para un clon ancestral obtenido a diferentes concentraciones de células en el mismo cultivo de crecimiento; las concentraciones se indican en el recuadro. Las tres referencias se representan en el panel de la derecha junto con las concentraciones de células correspondientes, como lo indican las flechas. (C) Se muestran las referencias de las distribuciones de tamaño celular sobre diferentes concentraciones celulares para los 12 clones aislados del ancestro (extremo izquierdo), linaje T (segundo desde la izquierda), linaje Svr (segundo desde la derecha) y linaje Mld ( extrema derecha) poblaciones. Cada panel incluye la distribución de AC (círculo), mientras que los otros clones se indican mediante cuadrados.

Por el contrario, todos los clones evolucionados en los linajes Svr y Mld mostraron sus propiedades evolucionadas por debajo de 108 células / ml y tenían diferentes dependencias de la concentración celular. El tamaño de celda de Svr22Cs era pequeño en valor medio, al igual que las líneas del 1% superior y el 1% inferior (segundo desde la derecha en la Figura 4C) y se volvió ligeramente insensible a las concentraciones celulares, en relación con los clones ancestros. Los Mld22C se volvieron notablemente densos alrededor de la media y mantuvieron su tamaño celular en varias concentraciones celulares (extremo derecho en la Figura 4C). Por tanto, la selección del tamaño a una concentración celular particular promueve la evolución del tamaño a las diferentes concentraciones celulares.

Además, probamos si las selecciones de tamaño son necesarias para mantener estos rasgos evolucionados. Para responder a esta pregunta, elegimos al azar 12 cepas de cada linaje y las propagamos durante 5 días en ausencia de selecciones de tamaño. Todos los aislamientos mantuvieron los rasgos correspondientes en tamaño sobre diferentes concentraciones de células (archivo adicional 3: Figura S3).

La resecuenciación del genoma completo reveló algunas mutaciones en genes relacionados con el crecimiento

Para comprender qué tipos de mutaciones causan la evolución del tamaño, examinamos la resecuenciación del genoma completo para las 4 poblaciones (AC, T22P, Svr22P y Mld22P, Tabla 2). Identificamos solo un SNP, que se encontró en la región codificante de la fosfátido citidililtransferasa, cdsA, en Svr22P. Este SNP es una mutación no sinónima que da como resultado una sustitución de aminoácidos de Glu a Lys en el 109º residuo. En Mld22P, también encontramos una inserción de base única en la región codificante de la transcetolasa, tktA. Esta inserción tampoco es sinónima pero con un desplazamiento de fotograma de Lys658. Teniendo en cuenta la tasa de mutación (5,4 × 10 −10 por pb por generación [21], [22]), el tamaño del genoma (4,6 × 10 6 pb) y el número de generaciones (200-400), se esperaba que la población evolucionada tener 5,4 × 10 −10 × 4,6 × 10 6 × (200–400)

0,5-1 mutaciones por individuo. Este valor concuerda racionalmente con el pequeño número de mutaciones que contribuyen a los cambios de tamaño celular. Por lo tanto, asumimos que estas pocas mutaciones por individuo son candidatos apropiados para inhibir la filamentación. El tamaño de población efectivo dado por la media armónica de los tamaños de transferencia (200-2000) y los tamaños de población final (1 × 10 7 –1 × 10 8) cada día fue de aproximadamente 200-2000, donde se muestran los tamaños de población finales de cada día en la Figura 3A. Por lo tanto, 0.5-1 mutaciones por individuo multiplicado por 200-2000 (individuos) dan 100-2000 mutaciones en una población sin selección. Estas estimaciones apoyan que las mutaciones que alteran el tamaño de las células fueron relativamente frecuentes, lo que sugiere la rapidez de la evolución del tamaño de las células en poblaciones bacterianas típicas con grandes tamaños de población.

Estos dos genes se involucran en diferentes vías, cdsA para la biosíntesis de fosfolípidos y tktA para la vía de la pentosa fosfato (Figura 5). cdsA es esencial para el crecimiento celular porque la enzima codificada proporciona fosfolípidos para construir la membrana celular. Por lo tanto, si el SNP hace cdsA defectuoso, el pequeño tamaño de las células de los mutantes es funcionalmente relevante. Un estudio reciente informó que un mutante defectuoso en la biosíntesis de ácidos grasos, que es la vía aguas arriba de la biosíntesis de fosfolípidos, exhibió un tamaño de célula pequeño en relación con MG1655 [13]. El rol de tktA no es esencial, pero vincula muchas vías importantes para el crecimiento, como la biosíntesis de ácidos grasos, la biosíntesis de aminoácidos aromáticos, la biosíntesis de vitaminas aromáticas, la biosíntesis de ácidos nucleicos y la glucólisis. Regulado al alza tktA promueve la producción de acetil-CoA y NADPH, con un aumento de la masa celular [23]. Además, el nivel de expresión de tktA está regulado a la baja en la fase de crecimiento estacionario, posiblemente por un factor sigma, rpoS, que se asocia con un tamaño de celda pequeño [24]. Suponiendo que la regulación a la baja o la deficiencia de tktA inhibe la biosíntesis de ácidos grasos a través de la falta de NADPH, un mutante defectuoso en tktA Entonces podría fallar en la construcción de la membrana celular de una manera similar a la defectuosa. cdsA.

Funciones de los genes diana en la síntesis de membranas. Se identificaron dos mutaciones genómicas en los genes tktA y cdsA, que participan en la síntesis de membranas a partir del metabolismo de la glucosa.En el flujo metabólico de la glucosa a la síntesis de la membrana, el TktA participa en la vía de las pentosas fosfato para producir NADPH, que es necesario para la síntesis de ácidos grasos. Al utilizar ácidos grasos, el CdsA participa en la síntesis de fosfolípidos de membrana, seguida de la construcción de la membrana, que afecta el tamaño de las células.

La evolución del tamaño celular no está asociada con una desventaja de crecimiento.

Si el tamaño celular de la población ancestral se evolucionó u optimizó de manera preliminar para el crecimiento, la selección del tamaño puede perturbarlo como resultado de compensaciones evolutivas. Como se señaló anteriormente, la tasa de crecimiento observada de la población en las rondas de selección podría estar sesgada por las selecciones de tamaño inicial. Por lo tanto, exploramos las características de crecimiento de todos los clones evolucionados sin selecciones de tamaño (Figura 6). Curiosamente, la tasa de crecimiento de Svr22C fue casi la misma que la de AC o T22C, dentro de la fase logarítmica. También encontramos que Mld22Cs creció más rápido que los ancestros independientemente de la presencia de selecciones de tamaño (Figura 6B). Estos resultados indican que la evolución del tamaño celular medio no se asoció necesariamente con una carga de crecimiento. Es decir, la evolución del tamaño de la célula podría lograrse sin fuertes limitaciones, como compensaciones entre el tamaño de la célula y la tasa de crecimiento. Esta conclusión apoya un acoplamiento débil del tamaño celular y la tasa de crecimiento, como se observó anteriormente en la evolución del tamaño a largo plazo en el grupo de Lenski [16].

Características de crecimiento de los clones evolucionados. (A) La curva de crecimiento promedio de los 12 clones aislados del ancestro (arriba a la izquierda), el linaje T (arriba a la derecha), el linaje Svr (abajo a la izquierda) y las poblaciones de linaje Mld (abajo a la derecha). Los círculos grises en el momento cero indican la concentración celular estimada del procedimiento de inoculación. Cada panel incluye la curva de crecimiento de AC (círculo abierto), mientras que los otros clones están indicados por círculos negros rellenos. Las barras de error representan las desviaciones estándar y la mayoría de las barras son muy pequeñas. (B) La tasa de crecimiento de los 12 clones aislados para la fase de crecimiento exponencial. La tasa de crecimiento se calcula a partir de la pendiente de las curvas de crecimiento durante la fase de crecimiento exponencial. Las barras de error son límites de confianza del 95%. PAG-los valores son para la prueba t (N = 12).

La rápida evolución del tamaño de las células implica estrategias de supervivencia en los entornos naturales.

El tamaño de las células bacterianas juega un papel importante en la supervivencia en diversas condiciones ambientales, como la disponibilidad de nutrientes y la depredación [5]. Por ejemplo, algunas bacterias de diferentes filos emplean la estrategia de reducción de tamaño o filamentación para protegerse de la depredación de los protistas [2], [25]. El cambio evolutivo a corto plazo observado a diversos tamaños puede contribuir a la sostenibilidad a través de una presión de pastoreo fluctuante o la disponibilidad de nutrientes en el entorno natural. Debido a que la trofodinámica, basada en el pastoreo y la disponibilidad de nutrientes, es bastante compleja en la naturaleza, la evolución del tamaño puede ser importante o incluso ventajosa. Estudios de campo anteriores exploraron el polimorfismo de tamaño dentro de algunos genotipos [26], [27]. Los microbios pueden lograr una aptitud total ajustando su distribución de tamaño para resolver trofodinámicas complejas.

La evolución dirigida hacia un tamaño mayor puede ocurrir sin defectos de crecimiento.

¿Es posible evolucionar hacia un tamaño más grande sin defectos de crecimiento, al igual que la evolución a un tamaño más pequeño? Algunas cepas bacterianas exhiben grandes morfotipos filamentosos que contribuyen a las estrategias antipredación. Al aplicar la puerta de clasificación para celdas de gran tamaño, se puede probar la evolución dirigida hacia un tamaño mayor. En principio, los morfotipos filamentosos podrían lograrse de dos formas extremas: una forma encadenada de varias células sin aumentar el volumen de cada célula y una forma alargada de células individuales con un aumento resultante en el volumen celular. Ambos tipos se observaron en varias bacterias, en determinadas condiciones. Debido a las limitaciones técnicas del clasificador de células, estos dos tipos eran indistinguibles a través de patrones de dispersión de luz. Por lo tanto, el resultado de la evolución podría depender de la competencia de crecimiento entre los dos tipos. Sin embargo, intentamos introducir la evolución en células filamentosas de gran tamaño sin defectos de crecimiento (linaje L, archivo adicional 4: figura S4 y archivo adicional 5: figura S5A – C). Después de 22 días, las distribuciones de tamaño se mantuvieron sin cambios con respecto a la del antepasado (archivo adicional 5: Figura S5D). La observación microscópica, sin embargo, reveló que la forma encadenada representó la mayoría de las celdas más largas (Archivo adicional 5: Figura S5E). La tinción de membrana FM4-64 mostró varios tabiques de membrana entre cada compartimento celular en un solo filamento (archivo adicional 6: Figura S6). Además, los tamaños de las células individuales dentro de un filamento se mantuvieron sin cambios. Por lo tanto, el régimen de selección más simple introdujo el morfotipo filamentoso, pero no logró introducir una evolución a un volumen mayor entre los septos, en un corto período de tiempo.

Además de la limitación instrumental en la selección de grandes tamaños de células en un filamento, una posible razón para el resultado es que una forma encadenada con muchos tabiques en división proporciona una ventaja de crecimiento inmediatamente después de la clasificación celular frente a la forma singular alargada. Para evitar tales supuestas competiciones de crecimiento inducidas por la inexactitud de clasificación y para eliminar los morfotipos engañosos, examinamos un régimen de selección alternativo (ciclo Ls, archivo adicional 7: Figura S7). Además de la selección del crecimiento durante la propagación, el método revisado consistió en la clasificación de una sola célula para las poblaciones con el mayor tamaño de célula. La clasificación unicelular podría aislar un posible mutante de las formas encadenadas, que son propensas a dividirse de inmediato. Sin embargo, una posible limitación de este método es que el cuello de botella unicelular podría permitir la fijación incidental de mutantes de crecimiento defectuoso en relación con los antepasados ​​por deriva genética. Sin embargo, después de 8 días, las células exhibieron distribuciones de mayor tamaño sin defectos de crecimiento durante la fase exponencial, antes de acumular mutaciones deletéreas (archivo adicional 8: figura S8 y archivo adicional 9: figura S9). Las observaciones microscópicas revelaron una forma larga y filamentosa, compuesta de células alargadas en la mayoría de los casos (Archivos adicionales 1, 2 y Archivo adicional 8: Figura S8F). Algunos filamentos contenían tabiques de membrana, pero los intervalos entre los tabiques eran más amplios que los de las células del linaje L, lo que es coherente con el alargamiento de cada célula. Por lo tanto, el régimen de selección revisado en el linaje Ls impulsó la evolución a un tamaño mayor dentro de 139 generaciones sin defectos de crecimiento.

Los aislados clonales de la población evolucionada en el linaje Ls también exhibieron un gran tamaño (archivo adicional 8: Figura S8E). Además, estos aislamientos mantuvieron su gran tamaño después de 5 días (80-90 generaciones) de propagación en ausencia de selecciones de tamaño (archivo adicional 3 y archivo adicional 10: Figura S10). Estos resultados indican que el gran tamaño evolucionado era heredable. Desafortunadamente, la resecuenciación del genoma completo no detectó sustituciones significativas de pares de bases ni pequeñas inserciones y deleciones. Por lo tanto, se necesitarían más análisis o técnicas superiores para detectar posibles firmas genéticas.


Biotecnología: Principios y procesos Preguntas de preguntas frecuentes de clase 12 con respuestas

Preguntas de tipo de opción múltiple

Pregunta 1.
Los microorganismos se pueden cultivar en los biorreactores mediante
(a) Apoyar el sistema de crecimiento
(b) Sistema de crecimiento agitado
(c) Sistema de .crecimiento suspendido
(d) Ambos (a) y (c)

Pregunta 2.
Nombre el fármaco utilizado en el tratamiento del cáncer producido mediante el uso de biotecnología.
(a) Terramicina
(b) HGH
(c) Insulina
(d) TSH
(e) Enterferon

Pregunta 3.
¿Durante la "clonación de genes", que se denomina "taxi genético"?
(una vacuna
(b) Plásmido
(c) Bacteria
(d) Protozoos

Pregunta 4.
La tecnología de hibridoma se ha utilizado con éxito en
(a) producción de híbridos somáticos
(b) síntesis de anticuerpos monoclonales
(c) síntesis de hemoglobina
(d) producción de alcohol a granel

Respuesta: (b) síntesis de anticuerpos monoclonales

Pregunta 5.
La introducción de plantas alimenticias desarrolladas por ingeniería genética no es deseable porque
(a) Estos productos son menos sabrosos en comparación con los productos ya existentes.
(b) El método es costoso
(c) La economía de los países en desarrollo puede sufrir.
(d) Existe peligro de entrada de virus y toxinas con los cultivos introducidos.

Respuesta: (a) Estos productos son menos sabrosos en comparación con los productos ya existentes.

Pregunta 6.
Las células de hibridoma son
(a) Células nerviosas de rana
(b) Células híbridas resultantes de células de mieloma
(c) Solo las células que tienen oncogenes
(d) Producto de la formación de esporas en bacterias.

Respuesta: (b) Células híbridas resultantes de células de mieloma

Pregunta 7.
La nueva cepa de bacterias producida por biotecnología en la industria del alcohol es
(a) Escherichia coli
(b) Saccharomyces cerevisiae
(c) Bacillus sabtilis
(d) Pseudomonas putida

Respuesta: (d) Pseudomonas putida

Pregunta 8.
El objetivo importante de la sección de biotecnología en la agricultura es
(a) Para producir variedades de plantas resistentes a las plagas.
(b) Para aumentar el contenido de nitrógeno
(c) Para disminuir el número de semillas
(d) Para aumentar el peso de la planta

Respuesta: a) Para producir variedades de plantas resistentes a las plagas.

Pregunta 9.
Las dos vitaminas fabricadas biotecnológicamente son
(a) Vitamina B12 y vitamina B6
(b) Vitamina B12 y vitamina B2
(c) Vitamina B6 y vitamina B2
(d) Vitamina B12 y vitamina B9

Respuesta: (b) Vitamina B12 y vitamina B2

Pregunta 10.
Algunas bacterias patógenas desarrollan resistencia a los antibióticos al
(a) Modificar sus paredes celulares
(b) Desarrollar las enzimas que modifican los antibióticos.
(c) Alterar el objetivo de los antibióticos debido a una mutación espontánea
(d) Todo lo anterior.

Pregunta 11.
¿Cuál fue el primer mamífero del mundo que se clonó con éxito a partir de una célula adulta?
(una oveja
(b) Mono
(c) Vaca
(d) Becerro

Pregunta 12.
¿Cuál de los siguientes orgánulos está asociado con la ingeniería genética?
(a) Plásmidos
(b) Plástidos
(c) Cloroplasto
(d) Mitocondrias

Pregunta 13.
¿Qué es el ADNc?
(a) ADN circular
(b) ADN clonado
(c) ADN producido a partir de la transcripción inversa de ARN
(d) ADN citoplásmico

Respuesta: (c) ADN producido a partir de la transcripción inversa de ARN

Pregunta 14.
La enzima EcoR-1 se obtiene de
(un virus
(b) Salmonella
(c) E. Coli
(d) Penicillium

Pregunta 15.
El primer híbrido de plantas artificiales se hizo alrededor de 1717 por
(a) Niño de Thomas Fair
(b) De Vries
(c) Borlaug
(d) Ninguno de estos

Respuesta: (a) Niño de Thomas Fair

Pregunta 16.
El gen fue sintetizado in vitro por
(a) Khorana
(b) Ochoa
(c) Hollay
(d) Nirenberg

Pregunta 1.
La proteína unicelular (SCP) proporciona un valioso suplemento rico en & # 8230 & # 8230 & # 8230 & # 8230 & # 8230 & # 8230. dieta.

Respuesta: Agrobacterium tumefaciens

Pregunta 3.
El ablandamiento de la fruta en el tomate es promovido por la enzima & # 8230 & # 8230 & # 8230 & # 8230 & # 8230 & # 8230. que degrada la pectina.

Pregunta 4.
Vacuna para & # 8230 & # 8230 & # 8230 & # 8230 & # 8230 & # 8230. se ha producido recientemente mediante ingeniería genética.

Pregunta 5.
La insulina humana producida genéticamente se denomina & # 8230 & # 8230 & # 8230 & # 8230 & # 8230 & # 8230.

Respuesta: Waksman y Woodruff

Respuesta: cereales, verduras y levadura.

Pregunta 1.
El origen de la replicación es responsable de iniciar la replicación del cromosoma.

Pregunta 2.
Las endonucleasas hacen un corte al final de la cadena de ADN.

Pregunta 3.
El bromuro de etidio es un agente de tinción en electroforesis.

Pregunta 4.
Los plásmidos están presentes en un solo número en una célula bacteriana.

Pregunta 5.
El cloranfenicol se utiliza como marcador en la selección de formatos trans en ingeniería genética.

Pregunta 6.
El ADN es una molécula hidrófoba.

Pregunta 7.
La microinyección se utiliza para ligar fragmentos de ADN.

Pregunta 8.
La pistola de genes se utiliza para inyectar ADN en las células huésped.

Pregunta 9.
La quitinasa se usa para disolver la pared celular de los hongos.

Pregunta 10.
La extracción de fenol se utiliza para purificar una muestra de ADN.

Pregunta 1.
¿Cuáles son los compuestos orgánicos producidos por un microorganismo que inhibe el crecimiento o mata a otro microorganismo llamado?

Pregunta 2.
¿Qué enzima se usa más comúnmente para el mejoramiento de cultivos en ingeniería genética?

Respuesta: Endonucleasas de restricción.

Pregunta 3.
¿Qué significa EFB?

Respuesta: Federación Europea de Biotecnología.

Pregunta 4.
Para producir múltiples copias de un gen, ¿qué técnica se utiliza?

Respuesta: PCR: reacción en cadena de la polimerasa.

Pregunta 5.
¿Qué son las tijeras moleculares?

Respuesta: Enzimas de restricción.

Pregunta 6.
¿Quién hizo el primer ADN recombinante?

Respuesta: 1972, Stanley Cohen y Herbert Boyer.

Pregunta 7.
Nombre la secuencia de bases específica donde cortan las enzimas de restricción

Respuesta: Secuencia de reconocimiento.

Pregunta 8.
Nombra la secuencia de ADN de pares de bases que se lee igual en dos cadenas si la orientación se mantiene igual.

Pregunta 9.
En una electroforesis en gel de agarosa, ¿en qué dirección se moverá el ADN?

Respuesta: Hacia el ánodo (electrodo positivo).

Pregunta 10.
¿Qué tan grandes producciones de compuestos bioquímicos se realizan?

Columna I Columna II
1. Ti-plásmido A. Componente del cromosoma bacteriano
2. Bacteriófagos B. Retrovirus
3. Molécula de ADN circular única C. Agrobacterium
4. Virus con capacidad de transcripción inversa D. Capa proteica de virus
5. Cápside E. Virus que infectan a las bacterias
Respuesta

Columna I Columna II
1. Ti-plásmido C. Agrobacterium
2. Bacteriófagos E. Virus que infectan a las bacterias
3. Molécula de ADN circular única A. Componente del cromosoma bacteriano
4. Virus con capacidad de transcripción inversa B. Retrovirus
5. Cápside D. Capa proteica de virus

Espero que la información proporcionada anteriormente sobre las preguntas de NCERT MCQ para la clase 12 de biología Capítulo 11 Biotecnología: principios y procesos con respuestas en formato PDF haya sido útil hasta cierto punto. Si tiene alguna otra consulta sobre CBSE Clase 12 Biología Biotecnología: Principios y procesos PQM Preguntas de opción múltiple con respuestas, no dude en comunicarse con nosotros para que podamos volver a contactarnos lo antes posible.


Ver el vídeo: E COLI 2020 (Febrero 2023).